Description :
From Genome Similarity Track
Location :
scaffold_118:8203- 10225
Transcript NameFunction/comments
g11899.t1hypothetical protein

Sequence
2022 bases(100 bases per row)
TGGCCGGAGTCACCCCTGGAGTCGTCGCTGGCACGACCCCTGGCGTCGTGCCTGGATTTGTGCCCGGTGAGGCGCCTGTGGGCTCGGAGGCAGCTGGTAC
TGAAGCCCCTGCGACTGAAGGTCCCGGTGTGCCGCATGTTGTCCCTGGAGTCGTCGCTGGCACGACCCCTGGCGTCGTGCCTGGATTTGTGCCCGGCGAG
GCGCCTGTGGGCACGGTTGCTGGCTCCGGTTTGGACTCGAACGACATTAGCCTCGTGAGTGAAACGATCGAGATACCGACCATGATGCTACGCAAACACC
ACCACCGTCACCACGATAACGAAGACGAAGACGAACAGCAGGGTGAGGAGACCGTGGTTGCCAGGATCGTGATCACGGGAAACTCGACAGACCTGATCAA
CATGATTGAGGCTGCACCTCTGCACCCACGACGCAATGATGGACTCAAGCTTCACCTGAAGAACGAGGACGCGTACGCTGAGGGCTACGTGCTGACGTAC
ATCTACGTGTTCGAGAAGAACCTGCTGCGTCGCGTTACCACGGCATTCTCGGGTGACGTGGTACTAAACGACGACGTGGTGACACTCGACGACGCAGAGG
CGGACGTCAAGTTCGCCTGCGTGGGCGACGCCAACCTGTACCTGGAGTCCAGCACCAACGCCACGTTGGCGTCGTTGGAGGTGGAAGTGACGGGCAACGG
TCTGGCGCAGCTGGAGATTCCCTCCGTGAACCTGGGGGGCGACTTCAACGTGGAAGTTGCTGGCAGCGGCGCCGTGGCCTTGATCACGAGCTCTCTGACT
GCTGACGACGTGAAGACCACGCTCTCTGGATCGGGCAACATTGTGGTGGACACGAGCGACCTGGAGGCTCAGAAGCTCGATGCAGCCGTGTACGGCTCTG
GTGTTGCTAGCTTTGCCACGGTGGGCTCGGTCGACAAGGAGACGCTGACGCTGTCCGGACCAGGTCAGCTGCTTGCTGGCTCGATCGTGGCGCGCAAGTC
GGATGTGGATGTGTGGGGTGACGGCGACATGCTCGTGCAGGTGACCGACCGACTCACGGTGTCCACGTCGGTGTGGGGCAAGGTGGGCTACGTGAACGCG
CCGCCCACGGATGTCAAGATCAAGGGCTGGTGGTTCTGGCGCGAGGCCAGCTCCATTGTGTACCCCGCCGCGGTGAACAAGGTGCTGATCTACGAGCCGG
CGACCGTGCCGTCCAAGCACCCGGTGTACTACTCGATCGAGACGGCCGAATCGGCGCTGTCGGATGACCCGGACTACGCGTTCGTGTCGGCCGAGTCCGC
CAACGTGGCGAACCTGATGACCACATCGTTGTCGAGCGTGGAGCAGACTGCTGCTGCCTCAACGGGCTCGCAGGGTCTGTTCTATGCGTTCTTCGGCGTG
GGCGTCGTGGTGGTGAACGTCGTGGCTGCCCGTTCGTGGGCGCAGCGCCGCGTGCGTCGTCACTACACACGTCTCCTCTAAGCATAAGACAGCGCGGTTG
GCAGCGTAGTGTAGCCTGGAAGGACAGAGCTCCACATCGGTTATAGTTTTGAAGAGCAAGAGGTGCGAGGAAGGCAGTGTTCTTTGAACGTATCGTTCGT
CAGACAGATCGCTTGGATACTCTGGCACGCGGCTGCAGATTCAGTAGCAGCAGTATGAAAGATTTGCGTCAACGACCAAGAAATCAGATCTATGTAACCC
AGCGCGCAATCACCGGGTTAAATTCAGAAATAGTTAAATCCGCTCATTTTTGGCTTCTTAAATAGGTGTAGCAGTTTAACACGCAGATTCTATTGGAGTT
TATCGTAAAAAACATCTCGACGGGTTGGGTGAAATGCGTGGGTACGCAAACTTGGATCCGCAGATCAAAAGGAGAGGGATCTTGGCCACAGTTCGATTCG
CAAAGTAAAGAAAAGAAGTAACAAGCGAAAATGGCTCTCACCGACGTTATCCTCGCTCCGTACGCCGCCGCCAAAGACGTCGCGCAGAGCATGAACCCGG
TGATGCTGGCCGCACTCGTCGC