Description :
From Genome Similarity Track
Location :
Scaffold_291:8202- 16412
Sequence
8210 bases(100 bases per row)
CATGAACGTGACGACCTTAGTCGCCTCGTCTATCGGGTTGGTCACAATATTCGAGACCAAATACCGTGCTCTCTGCGCGTAAGCATGGACATCATGCTAA
CCCTGCTGTAGGTCGAGGAACTCTGCCCTCGACCGGAACTCGTTTTGCGGGGGCTCAAATGCTTGTCTGAGCTCATCCTTGAAACCTCGTACGTGCTGAA
GCACGTAGGATCAGAGAGTCGGCGTCCATACGCCCAACTTCTCGCTCGTCCGCCAAGGCATGACATGGCGAACGCAACCTTGGACAACGTACGACGTCGA
GCCGCAATGGCAGTGTCGAGTTCGACAAGCTAACGGAGGAGAGGCTCGCCCTCTCTTCCGACATGTTGCTCACGTTTAGCTTCAACGACTGTCCACGCGG
TGTCGTCTCCGACGCCACCGTGGTAGAGGAAGCAGCATCACGCTGCTCCTTCATGATAAACCCGAGAGCAACACCATGTTGCTCTGTCGACGATAGCGTA
CGCAGCATCGCAGCTACTGCCGCCTCCCCAATGACTGTTGACAGTCGTTGGAGTGCCTCCCACTCTGGATCCGACAGGTGGAGGCAGTCAGCGCGTGCAA
CATGAGTTGCAGGCGAAGTGGAGCTTTCCATGGGCACCTCCGCGCTCATGAAAAGGTTCTCGGCCCCTCGTTCGTACAGCTCCGTACCAATTTCAGGTAG
TCGGTCGTTGGACGGACTACAAAGTGCTTCCAGGTGTAATGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTA
GGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACAAGTATACTTTAAACAAGATAAAGACTCCAAGTAGCGGGTTTTGGTAAAAGATGAGAACTGC
TATTTTTGTTTTATGTTTCTGACTTCCTCAAAATGTAATATTCTAAACTAGGAATCTGCCAACCGCTGGTTGGTAGGATTCTGCTAACATGCAATTCACT
CATTGGCTAAAAGATGCTGCTTTCAGCCAATTGAAATCCTAAATGTGCATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCATTGGTGTACCTT
ACACCAAGGTCGAGGAAGTGTTCAAACCTCTAACAGACATCGCAACAAGTGACTGTAGCCACTTGTGCGTGTAACCCCGTTACATCTTTCTTCTATTCCA
GGAAGAATGCCAGCGCTGGAAGGTCGTCGTGAGACTCTTGTAAATAAAGCGACGAGAGGGAGTTGCTGACAGGGGTGGTTCGCGCCTAATGAGATCTTGA
TATATAGAAAAATTGTTTTAAAATTTGTCCTGTCAAAATTTGTCCCATTGTGATACTATACATAATTGTAGTGTTGATCTTCCGGACGGATTAACCAGTT
AATAAGGGTTTTGGGCGTTGGATTTCGGTGCATCTTTTTAATGCGGGATAAAACGTGACCAAGGGCGGATAAAAGGGCGTATTAAACGGAGTCGCATTAA
ACCGTTTTATGTAGGTTTTGGAAGGCACCCATTAGGCGCCTTCCAAAATGGAGTATCCGTTGAGCCCAGAATCTCCATGCGCAACGCCTGAATGCGAAGG
TCCGGTCGAGTTCGAGATGGAAGATTTCCCGGAAGAGCGAAGTGTGATTGACACGTCTGTCTGCGCGATGGAGCTCCGTTTAGATAAGGTGCAAGTGGAA
GGTAACGACCTTCTATTTGTGGAAGGTCTCGTGCAAGGGCGACGTCTGAAAATGTTGGTTGACTCTGGAGCGACGCACACCATTGTGCGACGCGATCTGC
TAGTGGCTCCTGCTGGGACGCGGGAAGAAAGGATTCAGGCGAAGGAAGACTGTCCGTGACTACATCGAAGAAGTTCACGGTGGACATGACGGTGGAAGAT
CGCTTATGTCCAGTCGAGATGGTGGAGTGGCCCTTACGACAGGACTTTGACGGCATTCTCGGTAAGTCGTGGCTTCGTCGTGAGAACCCCGATATTGACT
GGGCGGCTGGCACTGTGTCGTAGCAACACCCACCTCGCCGTAATTTGCCTCGAGAATGGACACCACCTCCGGGTTCTAAACCGGAGATCGAATATGTAGA
CGCGGACGAATTTCAACGCAATCTCAGGACCGGGATGTAACGGATTTTCCCGAATACAAGACCTGTAGGAAATAGAAGTCCGGTCAGGAATTGGTTGGAG
TGCCTGAAAATAGAAGTCATGTATCAAATAAAAGACCGGACATTTATTTTTTTAACCCTTTCGTGAGCAAGTCACTAAGTATACTATACAAACTCAAGGT
ACTTGAAAATCAAAGGGGCATTCTGCTCCGTTCGAGCATGTAGCCATCCCTGCCTCTTGTTGGGTACACAAATGGAACAGGGCAAAATGCCCCCAACGGG
CAGGACAAACCTTGCGTCTTGATAGGCCAAAACAAAATCTTTATGGAGGGTCGCCTCGCTGAAAGGGCGCACGCGATTGACTGGGGTTGCAGAGGAAACG
GCACCTTGCTTCGACGGAAGCTGATCTGGAAAGAGTTGGACTATGAATATCTTCGCTATATCTTACGAGGGATGCGCTTGTTTGAAAGTATCCGAAGGTG
TCGTCGAAGGTAGTGCCAGGTTGGCATGCACGTTGTAGTGGGTACATGTAAAACAAGTAAAAGGCGCTTGTTGTACATGTCCAAGCTTTCTGCCAGGTGG
GGCGACCGAAGGCCACGATGTTGCCGTGTCAGGCTCTATTGGTAACATTGATGAACTTGAGCGAGCCCTTATCCTGAAGTCTACGCTACTCAGTGTGGAC
TACGGTTGGTCAACAGCTGCGATGAGCTGAACGCCCGTACGTTGGAGATCGACTGAACGAACCTGACCTGTTAGGGGATATACCTCCTGCGCCGCTCAAG
CCTGTGCAAACGTCGACAACGATCCGTCCATCCGACGGTACAGCTCCCGCTAAGCTTGCACGTCTTCACGCAGCTCGTGTGGGCATGCTCCAAGCCGATA
TTTTCAGGGCATGACCTATCCATATAATATCAAATCTACTACTATTTGTGCTGTAAAGCTTGAATTTCTGCTGAACACCACTCGGTCATGTACACTAACA
CTGCTGTGTTGCGTCATGGTGGGAAACGGTGCCGACGTCGGATACTATGAATATATATGTACTTCAATGTGGGCACTCAGTGAAGAACTGGTGCCAAGCA
AGCAATATTTGTACGATCCAAACTTCTACGTATCATTTTCATTCACATTTACCAGATTTTTGCCTAATACCATTGCGCTCAATAGTAAATCTACCACTCT
CACGACCCAAAGCATGTTGGTAAGAGTGAAGCACCATGTCGCCATTGCTGAAGCACGATGTTGGCGTAGGGTTCGAGTAGCGTCCCATCCATGCTAACGT
CGAGCGTGGCGTCTGTATCTAGGTTCGGCATCATGCCCCCCTTGCGGTCGTCAACCGTGGCGTCCGATCAGCGTGCCCACCTTGCCAGCTCCGAGCGTGG
CGTCCAGGTCAGGGTCCGGCATCATACCCTCCCAGCGTGCCGACCGAGCGTGGCATCCACGTCGGGGTACACAAACGTGCCGACCATGCCGTGGTCGCGC
GTGGCGTCCACGCCGGGTTCCGCCATCGTGCCGTCGAGCGTGGCGTCCTTGTCGGGGACCGGCAGCATGCCCTCCGTTCAGTCGTCTGCCGTGGCGTCAA
CGCCGGGGTCTGGCAGCGTGCTGTCCGTGCTGGCGTCGAGCGTGGCGTCCACGTCGGGTTCGGCAGCATGCTGTCCGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCGGGCGACATGTCGCGACCGAGGTATGAAGCATGAAGATGCCCAGCGGGCTGCGGCAGTGAGCACAGCGCTCTTGAAGGCCTTGAGAAGCAGTGAAGG
CATGGCTGCGGGGGCCAGGGCGAGTAGGGCCGCGGAGGCCAGCGCAGTGGTGGCGCGGCAAGACGTGTGGTGTGATGTCACTAAAGTAAATTTGTAAATA
GTGACACCCGAGAAGCTGCTGTTACCGAATAATGCTGTTGCAGACTAGCCAGTTGCTAATACACATGTACCGACTGTCGATACATACATAGACCTCTTGC
CTCAAGACGCCGATAGTAGCTCGAGTGTACGCGGCCGTGGATGTACGCGTCTCGGAGATGTCTGCTCTTAGCTTAGTGCCTCCCACATCGAGGAACGCAT
CCTACAGTACTGCTCGATGATCATGAGCAACAGGATATTCATGCTATGACGGAGTTATGTCGTCGTCGTAAGGTATACAAATGTTCATGGGTAGTTCATC
ATGATTAAGCTTAGCGGTTTGCGCTGGTGCGATGATTATTACATTGGCTTGGCCAGTCAGGACCCCTGATCAAAGGAAAATTCTGTTCACCAGGCCAGTA
TAGATTACGTGCAGTCACCGCAGATTTGGCCTTGCGTGTTTAATAGAGGCTAGTCAGGAAACCTTGCAAGGAAGGAGAAAACCTGTTCACCGTTGGTAAG
TGTGCTGCAGAATATCACGTTGCAATGAGTGGCTATTCAGGAAACCTAATGAGGATAAAACCTGTTCACCTTAAAATTGTTGGCAGTATTAGCGTTGCAT
TCTTTTGATTTAGCAGATAACGTTACTGTTGGTTTGCAGTAGTTTAGCTTTGCTTTTGGTGATGCAGTTGGAATTCATTGCAGTATCATGACTACTCAGG
AAAATCTAAACTAGGAAAAACCTGTTCGCCGTTCAAGGACATCGTACTCATAAGATAACCATGAAGGTTGAGGAGGTTGTCGTCTCACCCGCATATTATG
GTTGAAAAAGGGGCTATGGCTTCCCATATTCACAGATTAATCTATAGTGTGGGCTTGTCCACTCTAGTGACATTCGCCTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTAGTGCTG
GTCCGGCCAAGCGAAACACAGCTGATCCATACGATTGTAGGCTCGGGATTCCGGGGCGAGAACTCCACCAGCACGCTGCCACTGCCNCCTGGTCCAGGAT
TTCCTCTTGATCCTCCATCAAAGAAGCCCAGAACCGTCGTACGAGATGGAAGCATCGCTTCCTGCGTAGATACGTTACTTTCAGTCAGCAACTGATACGC
AATTTCTGCTGCACAGCGTTCTTGGAAACTCTGCGTCGTTACTGGTATTCTGCTACGGAGCCGACTGTATGCCTCCTTTAGTCTTTGGCTGAGGCCTATA
CTCCATGCTGCGATTGACGTCACCGTAGATGCTGAAGGGTGAGTCATTCCTGTTCTTCTCCGCCATATTATGTGTGCTGTCGTGGCCACCCCCAGTCTCC
ACATGCGTTGTACAATCGTGTACAGGTGATCCAGTGCTCCCTCCGTGACTTGCGAAGAATTATCGCTGGCGGCGTCCACGCACTTCTCCAACATCAGTGT
GGGTACCTGAATCAGCTGCATGCTGAAGATTTTTTTTATGTTAGTCCTAACGGAAACTTGCTTTCGCCCTGCTGTCTCCCATTGCTTCAAGAACACTTGC
CATAGGTGCTGCGCTGTAGGGCAGTTCCAAACCAGGTGCGAGAGGGTTAGTTGATCCATGGGATCACAGCATTCCTCCATACACCTCTTGTCCCGTAGTC
TTCTAGTCTTGATTCTATACATGGTCTGGAGTTGAAGATGTACGATGTTAATAGTAAGACTTATACACATTTAGTGCGTGTTGCTTTGGCCAAATGCGGT
ATATTCATGCATGTATTTGTCGGATGCGTACTTCTCGTGCATTCCTTACTACTTATATAACAGTAGATATAAGCGAAAGTCGTGCTTGCAGTTTCGTTAA
CGAGGCGTTTGTACTTTACGTGCCAAGTATGACATGAGCGATAGAATTCATGCTCTTAAACTCATTCGTTAATCGACGATTCGCCTTGCCATAGTGATAA
GCAGAAGTAACGTTGCCATTTCAGACAAAGGCGTAGTTCGGCCTTGTCAAATTACGCTATCCGACAGAGGCAGATTTCAGGCTTGTCATGTTGAAGAAAC
AAAGCGTAACTCTCATCAATGAGTTTGACTGATGTGGTATTCGTGCATATCTTGTCATGTTTACCGGTAGATGCGAACTTGTTGTGCATGCCTGGAGATT
AAAGACATAAGCGTATTCGTGCTTGTCTAATGGGCGAGCAACGGGACTTTTGTCAAGACAACCCTCTTAGAATAAACCAGAGTCATCGTTCTTCATGCAT
ATCGCATGATGTTCAATTTGGGAATACCGATCGGTAAGCCATTGAGTGGCATGTTTTGCCGATGCGTGGTTAGATGACATGAAGGCCCGTCTAGTATAGC
ATTAGCGCGCCGATGGCTTTACGGCTGAGGCGTTTGCCAGAAGCAACTTCACATTCGCATGTGGGGCAATATTCAGGGCTTATTCCTTCCTGTTTTCGTG
GGCATTGAGCAAGTTCGGCGAGTCAGCATTGCTGCTCTCATAAGCTATCTCGCTGGTATTGGGGATTAGCCTCCCAGCTTGGCAAGTGGCTAGCTCATGA
CATTGCGTTTCACGCAGTTAAATAGCTCTGGGATTGACATCCAGGCATTACGGTCTCCCATTTCTCGGATGTGCATTTGCACGTGTCATCGAGTGGTCGT
CTGGCACGGGGATTTCATCCGGCCGGCGCGTCGGCAGGACATCGACATCGGCCATGGAATATGTTTGCGCAGATTAATCGTCCGGCTGGTTCGTGTGTCG
CTTGTCGTGCCTTGCTTCATGTCGGCGCTTGTCGCGGGATGCGCTGAGTTGGGCAGCAGTCTGGTTGGGCCGTCTCCTTGTTGATCGCGTCCACATGCAA
CACCAGAATCTTCATCACAGTCGGTGAGCGGAGCGGCTGCACGAATTGGCATCGCCACTACACCGTGGTTGAGGTGCTTGTCATCGAGTGCCGTGCACTT
GCGGGTCTTCCTCACAGGAACTGGTATGGCGCGGGATGTTGTCGCTTGAGGCTTAGCTTGAGCTCATAACCTATGAAGGTAAGGGTAGGATCGTAGGAAC
GTAAAGAAGA