Description :
From Genome Similarity Track
Location :
contig_118:8201- 10224
Transcript NameFunction/comments
g13323.t1OWZ23003.1 hypothetical protein PHMEG_0002181 [Phytophthora megakarya

Sequence
2023 bases(100 bases per row)
CGCCTGTGGGCACGGTTGCTGGCTCCGGTTTGGACTCGAACGACATTAGCCTCGTGAGTGAAACGATCGAGATACCGACCATGATGCTACGCAAACACCA
CCACCGTCACCACGATAACGAAGACGAAGACGAACAGCAGGGTGAGGAGACCGTGGTTGCCAGGATCGTGATCACGGGAAACTCGACAGACCTGATCAAC
ATGATTGAGGCTGCACCTCTGCACCCACGACGCAATGATGGACTCAAGCTTCACCTGAAGAACGAGGACGCGTACGCCGAGGGCTACGTGCTGACGTACA
TCTACGTGTTCGAGAAGAACCTGCTGCGTCGCGTTACCACGGCATTCTCGGGTGACGTGGTACTAAACGACGACGTGGTGACACTCGACGACGCAGAGGC
GGACGTCAAGTTCGCCTGCGTGGGCGACGCCAACCTGTACCTGGAGTCCAGCACCAACGCCACGTTGGCGTCGTTGGAGGTGGAAGTGACGGGCAGCGGT
CTGGCGCAGCTGGAGATTCCCTCCGTGAACCTGGGGGGCGACTTCAACGTGGAAGTTGCTGGCAGCGGCGCCGTGGCCTTGATCACGAGCTCTCTGACTG
CTGACGACGTGAAGACCACGCTCTCTGGATCGGGCAACATTGTGGTGGACACGAGCGACCTGGAGGCTCAGAAGCTCGATGCAGCCGTGTACGGCTCTGG
TGTTGCTAGCTTTGCCACGGTGGGCTCGGTCGACAAGGAGACGCTGACGCTGTCCGGACCAGGTCAGCTGCTTGCTGGCTCGATCGTGGCGCGCAAGTCG
GATGTGGATGTGTGGGGTGACGGCGACATGCTCGTGCAGGTGACCGACCGACTCACGGTGTCCACGTCGGTGTGGGGCAAGGTGGGCTACGTGAACGCGC
CGCCCACGGATGTCAAGATCAAGGGCTGGTGGTTCTGGCGCGAGGCCAGCTCCATTGTGTACCCCGCCGCGGTGAACAAGGTGCTGATCTACGAGCCGGC
GACCGTGCCGTCCAAGCACCCGGTGTACTACTCGATCGAGACGGCCGAATCGGCGCTGTCGGATGACCCGGACTACGCGTTCGTGTCGGCCGAGTCCGCC
AACGTGGCGAACCTGATGACCACATCGTTGTCGAGCGTGGAGCAGACTGCTGCTGCCTCAACGGGCTCGCAGGGTCTGTTCTATGCGTTCTTCGGCGTGG
GCGTCGTGGTGGTGAACGTCGTGGCTGCCCGTTCGTGGGCGCAGCGCCGCGTGCGTCGTCACTACACACGTCTCCTCTAAGCATAAGACAGCGCGGTTGG
CAGCGTAGTGTAGCCTGGAAGGACAGAGCTCCACATCGGTTATAGTTTTGAAGAGCAAGAGGTGCGAGGAAGGCAGTGTTCTTTGAACGTATCGTTCGTC
AGACAGATCGCTTGGATACTCTGGCACGCGGCTGCAGATTCAGTAGCAGCAGTATGAAAGATTTGCGTCAACGACCAAGAAATCAGATCTATGTAACCCA
GCGCGCAATCACCGGGTTAAATTCAGAAATAGTTAAATCCGCTCATTTTTGGCTTCTTAAATAGGTGTAGCAGTTTAACACGCAGATTCTATTGGAGTTT
ATCGTAAAAAACATCTCGACGGGTTGGGTGAAATGCGTGGGTACGCAAACTTGGATCCGCAGATCAAAAGGAGAGGGATCTTGGCCACAGTTCGATTCGC
AAAGTAAAGAAAAGAAGTAACAAGCGAAAATGGCTCTCACCGACGTTATCCTCGCTCCGTACGCCGCCGCCAAAGACGTCGCGCAGAGCATGAACCCGGT
GATGCTGGCCGCACTCGTCGCCGTCGTGGTGGTCGTCAATGTGGTGGCCGCCAAGTCGTGGCAGGCGCGACGCAGCCGCCTCGAGTACAGTCCGCTGCTG
TAGACGCCCCCATCTATCCTTTGACGCTCAAACCACGGCCGGAATCCAGAGGCAGAAGACGCGAGCGGCGGCGTCGCGATCTTAAAATGTGGCACCGAGT
TTGACCCTCGTAGCTTCGTTTTG