Description :
From Genome Similarity Track
Location :
contig_118:8201- 10222
Transcript NameFunction/comments
g13850.t1OWZ23003.1 hypothetical protein PHMEG_0002181 [Phytophthora megakarya
g13851.t1hypothetical protein

Sequence
2021 bases(100 bases per row)
GGCGCCTGTGGGCACGGTTGCTGGCTCCGGTTTGGACTCGAACGACATCAGTCTCGTGAGTGAAACGATCGAGATACCGACCATGATGCTACGCAAACAC
CACCACCGTCACCACGAAGACGAAGACGAAGACGAACAGCAGGGTGAGGAGACCGTGGTTGCCAGGATCGTGATCACGGGAAACTCGACAGACCTGATCA
ACATGATTGAGGCTGCACCTCTGCACCCACGACGCAATGATGGACTCAAGCTTCACCTGAAGAACGAGGACGCGTACGCTGAGGGCTACGTGCTGACGTA
CATCTACGTGTTCGAGAAGAACCTGCTGCGTCGCGTTACCACGGCATTCTCGGGTGACGTGGTACTAAACGACGACGTGGTGACACTCGACGACGCAGAG
GCGGACGTCAAGTTCGCCTGCGTGGGCGACGCCAACCTGTACCTGGAGTCCAGCACCAACGCCACGTTGGCGTCGTTGGAGGTGGAAGTGACGGGCAACG
GTCTGGCGCAGCTGGAGATTCCCTCCGTGAACCTGGGGGGCGACTTCAACGTGGAAGTTGCTGGCAGCGGCGCCGTGGCCTTGATCACGAGCTCTCTGAC
TGCTGACGACGTGAAGACCACGCTCTCTGGATCGGGCAACATTGTGGTGGACACGAGCGACCTGGAGGCTCAGAAGCTCGATGCAGCCGTGTACGGCTCT
GGTGTTGCTAGCTTTGCCACGGTGGGCTCGGTCGACAAGGAGACGCTGACGCTGTCCGGACCAGGTCAGCTGCTTGCTGGCTCGATCGTGGCGCGCAAGT
CGGATGTGGATGTGTGGGGTGACGGCGACATGCTCGTGCAGGTGACCGACCGACTCACGGTGTCCACGTCGGTGTGGGGCAAGGTGGGCTACGTGAACGC
GCCGCCCACGGATGTCAAGATCAAGGGCTGGTGGTTCTGGCGCGAGGCCAGCTCCATTGTGTACCCCGCCGCGGTGAACAAGGTGCTGATCTACGAGCCG
GCGACCGTGCCGTCCAAGCACCCGGTGTACTACTCGATCGAGACGGCCGAATCGGCGCTGTCGGATGACCCGGACTACGCGTTCGTGTCGGCCGAGTCCG
CCAACGTGGCGAACCTGATGACCACATCGTTGTCGAGCGTGGAGCAGACTGCTGCTGCCTCAACGGGCTCGCAGGGTCTGTTCTATGCGTTCTTCGGCGT
GGGCGTCGTGGTGGTGAACGTCGTGGCTGCCCGTTCGTGGGCGCAGCGCCGCGTGCGTCGTCACTACACACGTCTCCTCTAAGCATAAGACAGCGCGGTT
GGCAGCGTAGTGTAGCCTGGAAGGACAGAGCTCCACATCGGTTATAGTTTTGAAGAGCAAGAGGTGCGAGGAAGGCAGTGTTCTTTGAACGTATCGTTCG
TCAGACAGATCGCTTGGATACTCTGGCACGCGGCTGCAGATTCAGTAGCAGCAGTATGAAAGATTTGCGTCAACGACCAAGAAATCAGATCTATGTAACC
CAGCGCGCAATCACCGGGTTAAATTCAGACCTAGTTAAATCCGCTCATTTTTGGCTTCTTAAATAGGTGTAGCAGTTTAACACGCAGATTCTATTGGAGT
TTATCGTAAAAAACATCTCGACGGGTTGGGTGAAATGCGTGGGTACGCAAACTTGGATCCGCAGATCAAAAGGAGAGGGATCTTGGCCACAGTTCGATTC
GCAAAGTAAAGAAAAGAAGTAACAAGCGAAAATGGCTCTCACCGACGTTATCCTCGCTCCGTACGCCGCCGCCAAAGACGTCGCGCAGAGCATGAACCCG
GTGATGCTGGCCGCACTCGTCGCCATCGTGGTGGTCGTCAATGTGGTGGCCGCCAAGTCGTGGCAGGCGCGACGCAGCCGCCTCGAGTACAGTCCGCTGC
TGTAGACGCCCCCATCTATCCTTTGACGCTCAAACCACGGCCGGAATCCAGAGGCAGAAGACGCGAGCGGCGGCGTCGCGATCTTAAAATGTGGCACCGA
GTTTGACCCTCGTTGCTTCGT