Description :
From Genome Similarity Track
Location :
Scaffold_19:82001- 89209
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.46Phospholipase D; Pi-TM-PLD
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.63Tubulin-specific chaperone D

Sequence
7208 bases(100 bases per row)
TTGTATCTCTACGCGGGCGTACTCAACTCGATGATGGGCAGCTTTCTCTCCGCGAGCGGTTACTGCTGCCAGAAATGGGCTCACAACCGCGTGAAGCTCA
CGCCTGCGCTTGGGGTCGCGTCGCAGCAGCGTGTGTTCGTGCTCGGACTCTTCCTACTCGCTATGGGGACAGTCTCCGCGGTGCTGAACCTCGGTATCCT
CGGACAGGCTGTGCAGGCACCGTTCGCCGCGCTGACGCTCATCTACAGCGCGTTGCTGGGTCATTTCGTGCTCAAGGAAGACTTCCTGGTCTCCGACTTC
TTCTCCAGCGTGCTTATCGTGCTGGGTGTCGCCGTCGATGTGTACGCCGCGCAGCTCTCGAACGTTCCCCAGCAGACGTATACACTCAAGACGCTGGGCA
AACTGTTCTTCAGGGACTCGATTTTCCCATTAGGCTACGCAATGCTGGCGCTCGCCTACACGATGCTGATCCTGCGCCAAGTGCACAACAACAACCTGCA
CCACCGCGCGATTGGGTTGTTGGCGTTCAGCTCATGCGCGGGCATCATGGCCGGGTTCACGAGTCTCACGACAAAGTCGGCGGTCGAAGTGAGCAAATCC
GCCGTGCGGCATCACAACTGGGACATGCTGAACCCATTCTTCGTGTTGATCATCATCGGCATCCCAAGCGCGCTGATCCCGCAGCTGTTCTTCCTCAACA
AAGGGCTCGAGTACTTTGGCACGCTCAAGTTCATCCCGCTGTACCAGGCGTTCATCATCCTAGGCAACATGGTCTGCGGCATGGTGTTCTACAATGAGAT
GGCGAGCTACACGCTCGAGTCCGTGATTTGTTTCCTCGCGGGCATCGCGATCACGCTCTCCGGTGTGTGTCTGCTGCTTATGAAAGTCGACAGTCAGCAC
AACCAGATTCGAGATCTGAGCAGTCTGGGCAGCAGCAACATTGTCAACCAAGGAACGATGGATCCGGTGAACGCCAAGCACCTCGCGACAGATTTCAGCT
TTGAGCAGATGGAGTGGGCGACCAGCGGCGACAATGGCGACAACGACGGCAGTTTGACCACGCTCAAGGACTTTGAGGCGTGCAAGCTGAGCATCGTCAA
GCTGCTGAGTTCCGCAACCGCGTCCGTGTACTACTCGACGTTCCTCTGCGACTTCACGCAGGTGCTGGGGTACTCGGACCTGGACGGTGAGCCAATCACG
TTCATCTCGCTCGTCCAAGCAGCGGTCAAGCGTGGCGTGAAGGTGCACATTCTCTACAACCCTGTGGTCGATTACGGCACCGAGTCGGTCGCGGAGCTGC
AGCAGCAATTGCCGCACGAAGTACAATTGTCGTGCTGCGTGAGCGATCTCGGCCCGAGTTTCTTCACGAAATGCCTCTCGAACAATTCGAAATACGCGTT
CCACCACCAGAAGTACCTCTTGATCGACGAGAGCGTACTCATGGTCACGGGCTGCGACGTCAACTCGGAGCGCGAAGGCTGGCTCAGAGAGAATACGCTT
GGCTACTTTTGGCACGAGCTCGGTGTCGTGACGCGCTGCACTTCCAAGATGGTCGCGTGGATCAAGAGGAACCACGCTGCGACCACCTTGGGGAGAAAGA
AGCGTCACTATGATGAATTTGTCGACGCGGCGCCGTTCCCGCTGGTCTCTGGCGGCTGGCGCGAAGAGAACGCGATGGTGAACATGATCCTGCACGCCCA
ACACTCGGTACAGCTCGAGAATCAGATCCTGATCTCCGGAGGAACGATGCAGCACAACCGGGTTTGCGACGCGATCATCGCGCGCATTTGCCAGGCGCAG
CGTCAGCAAACGCCGTTCCACGCGCTCATTCTGACCAACGCAGCGCAGCAAGACGAGCCCTCGCAGGTCACGCGCCTGTACTGCTCGCTCTCGATCCAGT
GGTCGCTCGAACAGCTCGAGAACCGCGCGCTTGATAATGGACTGACGCTCGAAGAGCTCCACAAGTATCTGATCGTCGGTCGCATGGAGTTCAACGGCGT
GCTGATCAAAGTGCACTCGAACATCCTGATCATCGACGGCCAGTACGCGCTGCGCTCGTCCTCGAATCTCGCCGATCGGAGTCTGAGTTCGCGTCCGACA
GATACGGAGCTGGGGTTGCTCTTTGCCGGTGATGCGGTGCACAACTTCCAGCAAGAGCTGCTCAACATGTACTTTTGCACCACGGGCGTGGAGTACTCGA
TGGCGGACGTATTTGAGCTCATTCGTTATAAACAGCGAGGTGATGGTATTGATTGCTGCATTGTGCCACTGGAGAAGAAGAATTGGAGCCCCGTGCTCAC
GTGGTTTCTGATGAACGTGTTCATCTACGGGAGCGAAGGCGCGACTGGCGGGCGGTACAAAGTGTCGTACGAGACCTCGGTTGTCACACTTCCCAAAGAA
GAAGCGCCGACTGTGCGAATTGGATTGAGCGCTGCAGTTGCCTGTTAGAATGCTAACCTGGTGCGTTTTGGATGATGTTGGTAGGGAAATATGGAGGAGA
GACAGAGAATACCAATACATGTGTTTGTTTCATATCCATCCAGTTAGCTTGTTTGTTCGCTCGATTGCTTCGCACGCCAAGGACGTGAGGCTTTTAATAT
CCCATCTCTTTCACGAGCGCGCCGTAGCTCTCGGAATCGCCGCCACCACTCGCTTGCGTAGCCAATGTCGCTTCTGGGCGTCTACAGCAATAGACAACAG
CGTGCATGTCAGAAAACAGTTGCCAATGAGGTCGCATTGCATCCGTGCAGCACGTACTGTTTCTTGGTCGGTCTCTCCATGTCGAGGACGTCTAGAAGCT
GGTTTCGTGCCTCTCGTACTTGCGTGATCTTCATACAAAATACAGCACAAACACAAACAGCGTCAGCCAAACACGCTGTGGAGTCGCTGCAGAGCGAGAA
TCACGCGATGTGTGAACGTACCGAGGCATCCCAGGCTGTCTCACTCAAGATCTCAACCACGGAATCGTACTGCAGCAATACATCCGCAATAATGTCGTCA
GTCCATTTACACACAGCTATCGAGAGAACAACCAAATAAAAGCATACCTTGCTCTCGTCGACGACTTCTTCATGCACCAGCAATCGCGTGTAGAGCTTTT
CGGCTGTCAGTTTGCGCACTTTCGGGAACCGGTGACCGAGGAACAACAGCAGTGCCTTCAGCGCCTTGTTCTCTGTCTCTGGCTCACTTGGCAACAAACC
CGTCAGCACAGCAACCCCCGCTGCGATCTTTGCCACCGACGTCGATTTCTGAATCTCGTCGCGAAGCGCAGCGTACAGTTTCTCGCCAAAGTCGACTTTC
GTGTCGGCGTCGCGCTTCTCAAAGAGAAAACCCAGTAAGTTGGACTCCAAGAGGATCGCGATCGTCTTCATGAGAGGCAGCGTCACACGGTCTTCCTGGC
TGTGACGTGTCAGTAGCGTCACGAGGAAGAATGAGAAGCGCGTAAGTAGGCCAAAGTTCTTTTGCTGCACGTGGTATCGCACCCAGCCGAACAGTGCGGC
TTTCGACGATTTCACGACACTCTCGGTGAGTCCACCGACGCTGAGCACGAGACCACTGACGACTGCTTCCAGGTACTCGGGGATGCTCATCATCTGCACC
ACGAGCGGGAACGTATCGTGCGCCATCGACCAATTTACTTGAAGGGAATGAGGGAAAATCTGCTTCTCGAGCTGAAGACGATCAGGAATCGCATCCACGC
GCGGGTTTGACGAGTGCAGCAGTCGAAAGAGCGCTTTGCCAGCGACGAGACGCATACCGTCCAGTTTCTCTGCCAGCTGCTTGCCAAGCTCACAAAACTG
GTGGCGCAAACACAAGATAAGAGAGTATGTTAGCATGTGCATCGCAGCGGAAACACAACAGCATTCAAACGAAAGGACTCACGAATTCACCGACGAGATG
CGCTGAAACGCGTCGCGCAAACGGCTTCTGGCGTGCTGCAATTGCAATTGACGATGTCTCCAGTCCATTTTTGCTTTCGTGCTGCTCAGTGAATTTCAGG
CGGTCAGCGAAACTGGGAAGTTGGAAAGTGATCCCCTCAGCACCAATTTGACCATTTCTCACTTTTTCTTCGTTGCTGATGCGTAGCTTGCTCAAGCGGA
TGAGACCCAAACCGTTGGGTGGGAAGTAGTAGAATCCCTGGGAAGGTTTCTCGAATTGCACAAAGCAGATTGGATCTTTCGCCGCCGAGTGGTCGTCTTC
AAGTCTTGGTCCTGTTACCACACGCGCAATCTTCCCCTCTCCATATACACTGCCGACAGCGAAGTCCATGAGTGAGCTGAGCTTCGTTTCATCGTAGCTG
CTCTCTTCGAGGAACAGCGTCTCCAAACCCAAGATCGCTTCTTTTCGGATCCACGAGCCGACGTCTCCACGTTCATCGACACCGTAATCTTGCTGAATGC
ACTGCACCAAAGTGTGCACAATGTCGTCTTCGAGGTCCTGGAGATCGAGGTTGTTGCTCGTCCGGGAGCAGATGTCCACGATCGCGCGCACCGCGGCAAC
GCGGCTCTCAGCATCCTGCTCGTCTGCTGTTTGTTGGCCAATTGAAGCTGCTCGCAGTAGCGTTTTTACACAATCCATGATCGTTGGCTGCAGCAATTCC
TTTGAAGCGACACCGATTGCACGGATGAATCCTCGTCTCGCAGCGACGTTCGGGTTGAACACGACACTGGACACGCCGCGCTCTTTTACTATCATGAGCA
CACCAGCATTCAGGTACCGCGGTACGAGCTCTCGTAGGAATTTCACATGCACCGCGCTGCCTTTCTCGAAAATCCTGGCGCAGTACTGAGCTGTGAACAC
CGAGAACGCGTCGATCGCAGCCGTGCGAACACTCTCAACGGGGTGCACAAAGCACTCTTCCAGGATCGCAAAATATTTCTTCACATGAGCAAAGCTCAGC
GTCAGTCCCGCGCGTGAGATCACTTCGATGATGTTGCACACTGCTGCGCGGATCATCTCGCCGCCGCGGCCTCGGAACAAGCGTTTCTTGTCCACTTCGA
TCGGCATCATCTTGAGCTCTTTCTGGAGCTCGCCGTCCAGGAACACGGGCACTTGTGCGAGTGACATGAGCAGCTCCGCTAGTGCGATCGTCGCGCCGTG
ACGCGTAATCACTTCCACGTCGGCCGATAGCGCGGAAGACAGTAGGCGAGGGGACAATTGTGTCATGGCAAACGTGGGGTCCAGCGTCGCGATCCTGCCC
AGCGCCGCAGCAGCGTGGGTACGAATCTGTACGTCCCAGTGCGAGATCTTGGTCGAGATGAGGTGTTCAAGTAGGTGATAACGGTACTCCGGGTATTTCG
CGATGAAGACACTCACGTCCAGGTACGCATGACGGAGATTCGATACCGAGAAGTAGTCGGCTTTCGTTAGTAGATCAATGCCGTGGGGGAAATTCGCACG
ACCCTGGCGGCCAACGCATTCCTGGAACGCGGCAGACGCTGCGCGACGGCAATTGAGCTCGCGATCAAATACGCAGTTCACGAGCATCGCTGGCGCGAGC
GTCTTTTCGAGACATGGCAGGAACAGCAGCGGCTCGTACGCTCTCGCAAACGACCAGCAAGCGTAGCAGGCTGCGTCACGCACGTGCGAGCCGATACTGT
GCGCACCTCGTCGGATATCATAGCAGAGTGCACGAGCGACACACTGCGCTGCTTCAGGTAGTCTCTGCGGTAACAATACTCCACGCCGTGCCAGTTCTGC
GAGCGCCAGGCTCGCCCCGTGCCACGCACCATCCCCTTCTGTCGCAATAAAGAGCTCCAACACAGACTGAACAATATCGTCTGCGAATTCGTATGGTAGC
CGTCCGGTGATGCGGCCGATACCCTTTGCTGCCGACCAGCGCACCACTGTGTCTTTGTCTCGAAGTCCACAAAGTAGAACCTCGACGATCTGCTCCAGCT
CTTCGATTGCCTCGAGCTCCACGTCATCGTCTTCCTCCAGTTGCTGTGCTTTTGAGGCAGATGATGCATCCGCAGCATCTGATCCTCCTGGAAGCAAACC
CAGCGACTGCATGTTCATTTCGAGCGAGCGCAAGCCACGCTGGTAGCGCCACGAGCGCACTCGAGGCGGCAGATATAAAAGTCCGAGTCGCTGGACGAGC
TTCACGCTCAGTTTGCGATGCAAAGTGCTGCTGCTCGGTCGGTCTGTGCGAGCATCTTCCTCCGCCATCCGCGAGATGAGCTGCATGACGCTCTTGAAGT
AGATCCGACTCGCCTGGATGTGCTGCTCGCGCGGCGAGTTCTTGGCGATGTGCGCGAGACTGAGCATGACGCCCGTTACGCGGAACTGGTTTGCGCGCAT
GTCCTCACCCTGATGCGCAGTCGTAAGCTCGCTGTTTGCCCAGGCCAGGAAACGGTTGAGGTAGTGCGCCTCCATGTCTGGGCGGCTCAGTAGGCGTGAC
AGACACACGGACGCAGCGACCTGGGTTGACCCTGGATCCCCCAGGTATTCCTTGCAAAGCGTCAGGATGTTGGACACAATCGAAATGTTGCCATTGATCG
TGTCGGCAGCTGTCGTGATGGATGAGTCGATCGTGTTGAGGTCGAACGGCACAAGACAGAGCATCGAGAGCCACAGTAGCAGCACGTAGCGCGTCTCCCA
TGTGCTGTGGTCCGCGCGGTCCTGGGACTGCAGCAGCATCAGCGTCGGCTCAAAGTCGCTCACTTCGTGCGGCAGCATCTTCACAATTGTCTTGTAACCA
CGCACTTTGCAAAGATGGTAGATCAGCTGGAAGAGTTTGTGCAGCTTCGGGTTCTTGTACACTTGAAATGGAAACGCCACGATGCGCTCCTCCGTCGCTC
GCTGTACACTCACGCGCGCGTCTTCACGCTCCTGCGCAACAGCTGTGATCACGCTCTTGACTTGTGTCGTGATCGGCTCGATCATCTCGTGCAGGAACGG
GTCCAGGAGGTGCGACTGCTCCAAGTACCTGTCGAACTATCAGCATAGCACCAAGCTCACGTAAACAACAACGTGCATGCAAGTGCTGAAATACAACAAT
ACCATTAAGCGCGACGCATACGCACGTACAATAGCGGTGACGGTCTTGAACTTGAGCTCAAACTCGGCGTCCACCTCGCTCTCGTGGGTCGGAAACTCCT
TCGCGAGCAGCTCCCGCAGCAGCTGCGCCACCTGCTCGCGCTCATCGAAGAACTTCTTCTCGCTGCAGCTCTCTTCACCCTGGAGCTCGCTGGCGTCTTC
AGTATCGC