Description :
From Genome Similarity Track
Location :
Scaffold_8:820- 8368
Transcript NameFunction/comments
Phyag_g247hypothetical protein PHYSODRAFT_542020
Phyag_g248hypothetical protein
Phyag_g249hypothetical protein PHYSODRAFT_328767
Phyag_g250hypothetical protein

Sequence
7548 bases(100 bases per row)
ATGGCGGCGTTCCTGGGGCTTcgccgactgctgctggtccgCTCACAGCATGCTCTGGGCGCGCGTTTAgcgcgcagcttcagcgccgcTGCCTCGACGG
acgctcctcgtcgccgcgtGTGCGTAGTCGGCTCCGGTCCCGCCGGATTCTACGCTTCCAAGTACCTACTCAAAGAGCACGCCGGCGCTCGCGTGGACAT
GCTGGAGGCGCTCCCCACTCCGTTCGGCCTTGTGCGTTCAGGCGTGGCACCCGACCACCCGGAGGTGAAGAGCGTCATGAACGACTTTGACAAAGTGGCG
GCCGACGAGCGCTTCCGCTTCCTGGGGAACGTGCGGGTGGGTGAGGACGTGACgctcacggagctgcagcagaactACCACGCTGTAGTGCTGGCCTacg
gtgcagcaggagaccGCGAACTGGCAGTCCCGGGCGAAGACCTGCGTGGTGTCCTGTCGGCGCGCTCGTTCGTGAACTGGTACAATGGACACCCCGCATT
CCGCGATCTCCAGCTAGACTTGAAGGAGGCAGGGACGGCGGTCGTCATCGGCCAGGGCAACGTGGCCGTGGACTGTTCACGTATCCTCACCAAGaacgtg
gacgagctggcgaCCACAGATATTGCAGCACATgcggtggaggcgctgcgcAACAGCGGCATCAAAAAGGTTTTTCTGGTGGGACGACGCGGCAGTGCGC
AGGCGGCGTTCacgatgaaggagatccGAGAGCTGACCAAACTGGACGGCGTAGCGTGCATCGTTGACCCGGAGGATTTGAAGGGCAGCATGACGCCTGC
GTCAGAGCAAGAGATTAAGGAGCAGCGCGCACGGAAGCGCATGAATGACTTGCTGACCAAGGCGGCGGAACAGTTTGAGAAGACCGGTGACGCGAAACGA
GTTGTGCAGATCAAGTTCCTGGCCTCTCCTGCTGAGATTATCGCGGACGAGAACGACCCAACTCGAGTGGGAGCTATTTGTGTGGAGAAGACGAGGCTGG
AGGGCGAGCCAAACCAGCAGCGTGCTGTAGGAACTGGTGAGTTTGAGGAGATCCCGTGCAACCTCGTACTACGTAGCATTGGCTACAAATCGCTACCCAT
CGAGGCAGGTGTGCCTTTTGATGAGCGGCGTCACGTTCTTTCGAATGAACAGGGACGTATTGTCACTACGTCAAGCAACGGTGAGACGACGCCTGCGGTG
GGTTTGTACTGCACCGGGTGGGTGAAACGTGGGCCTTCTGGTATTATCGGCACCAACATTGTGGACGCACGTGAGACGGTAAGCTGCATTGTCGAGGACT
TTGCAGCAGGAAACTTCCTTCACAGTGAAAACAGCGCTGCTGAGGACTTGGGCGGACTAGATgctgtggagaagctcatcAAGAAGCGTAACCCGGACAA
GCAGCTCGTTAGATGGGCTGACTACGAGCGTCTTAACTCCGAGGAGAACCGCCGCGGTGAACTCGTCGGGAAACCTCGCGAGAAGGTTACCTCCGTGACA
gagatgctggagatcgCGAAAAGTGTCACGTAATGTAACTACGTGCAGTAGCGGCGACTTGAAAGCGATCGTGTACAGATTAGACGTGCGCACAACCTTG
GAATTTTCCTAAACACGACCAAGGATGAGGTCCTCTAGTTCATCAAACCGTTGCGCTCTTTTTGACGAGTAAGTGCGGCATTTGCGGCTTTCAGCGCGCG
TGTCTTCTTGCGCTAATGGAGGGCCGATTATGAAAGGTGAAGCCGTTAGTTTCTTCCTGGTTATCACGGGAAATGAATCGTGTCGTACCTCCTCCTCTAA
CAGTCTCATTAGACGTCGACACTCCGATGCGACGTCTTCGGCCCCATTAGCAATGGGCAGTTCTGTCGGTCCAGATTGAGATTGAAGTGCATCGCTCCTA
CTCTGGGGCTGCCCGCATGCAGATGCCTCGTTGTCGGCGAAAGTGAAAGAATCAACGAGAGGTTGGTTTACCCGGTcacgcagagctgctgcgtacGTTG
GCTTGGTTCTTCGCACTGGCGCTGACACTGGGCGCGATAATGTGATTCGGTTTATCGCTGATGGCATGGGTGTAGCAGAGCGCGAGTGTTGTAATGGGAG
TCGCGCTGCTACCGTCGCCATCTACAGCCGCATCACAATTTCACGGTTAGGAAATATGGGTGCTGCTAACACAGACGCAACTACATTGAAGGAGTTCCTA
CAATGGCTTTCACGTGCCGCAACTTCGTTGGGTCTGCCAGGATATTTCTCGGCAATGAAAACGCGCTGGAGCAAACGCATCACAAGTTAGCGATGCATAC
CACAACGAAAACACGATTTTGAGCTGTCCATACCGCTGACTCGTATCCACTGCGCTTAGTACCCGCCCAACGTACGTGTACAGCTCCAGGCAATCCTCCC
GGATATTCTGCGTTAGCACAGGATAGTATCAGAACTCCATTTCATATGCAACCCCAGATCATAGTCCGCCACACACATCCATTGTATCAGTAGTagtttg
ctgcaattgctgtaGCTTGCTGTTTGTCGCATTGAGCTCTTCCGTCTTTCCTTTTAGGGAATGTTCGTACTGAGGACGCAGCAAAATAGTTAGCAAAATG
ATCCCGAGTAAAGCAGAATGTAATTTGACATATCTCCTACCTGTTGTCGGATGAGAGCAATCTCATTCTCTTTCGATTTCTGCAAGGCTGCCACCCGTTG
ACGTAATTTCTGGATAAAGAAAACATGACATATTAGCTGTATGCTCAGATGCACAAAGCAACACAGTAATATTCCAcctgctcgaacagcttTTCACGAT
CTTTTGGGTTCTCGCCAGCTTCCACTTGAGAGTTAAAGAGCGAAACGGACTGCTGCTGATAGGGGGCCTGACTACCCAAACTTGCCTGCATCAGGTTGTT
GCGGCTTAGGAGGTTCTGCATTTCTGCTCGATGCCGGGTGGCTTCCGATGCCAAAGCGCGCTCATACTCGCTCGATTTTTGATGTAAGCAACTTTCCAGC
GTGGAAATTCTTCGCTTCTGCTCATTTATGACTCGCCGCGCAGTCTCCTTATCCTTATTCGCTTCAGTCtagaaaaaaaaagcaaCAACGAGATGAGGTA
TAGCAAGTTCAAGCTCATTAGACGGAAACCTGCTAGGCACCCACCACGACTTCCGTGAAATTACTTTTTGCATTGGCATATTTTTGTCGTAAGCGGTCTC
GGGCATTacgagcttcttcggctgctaTCGATGCAAACAAATGCGGTGAGCAGGGAATTCTGGGTACTTGCTGAACGACTTAGTCACGAACCATTCGCTC
TTAGCAACCCTTGCGCATGCCCGGTAGACCCAGGATGTTTACTTTTTAAAAATGTGCTAGAATCTGTAACACGATCCCCGTGATTGTGTTCGTCTGAAAA
CACGGACTTCAACACCAGACCATCCTACGGCGTAAAACATACAGCATCAATTGATCATCAACTGGTATCCCGTTCGACGCAATTGTGAGATGTACCGCAA
ACTTGATTTCGCCATTATCCGAGATTTCTTCGGCCTGAAAGCCGAGATCGTTCAGCGTGGCGACAAACCTGTGGTTGTATTCGGCACGTAAACCCTCCAA
CTGTCGGCGCAAGGTGCTCAGCTCTTCTTGAAGTTTCCGAATGCGACGATCTTTATCTGCAACAGTACCGTTGATGTGGTTTACGCGGGGCTACCGTTTT
AAATTTCCACGTTAGTGAAGGTTTGCAGCGCCAATATTGGCATCGCTTACTTGATTCTGTACGGATCGACAGCGGTTGGCAAACTGTAGAGTTCCCAAGC
ATTCTTCGTAGTGCTCTTTCATCGGGTGAATCGTTGCAATGAGTGTGGTAAAACAATTGCCACCTGCACAATAATAAATAACGCAGAAACAGGGTTGGTC
TACAAAGTCAATCATGATGGCACTTTTAGTCATGGCAAGTCAAGTACGAACCAATACTATTCTGCAGGAGGCGTGTGAGCTTTGAGTCTCGATACGGGAT
GTAGTTATAGCCGCTCTCTGGATCCAGAGACATTACAACTTTGCCTACAGCGCTCAAACTCGAGTTAATATGTAATGCCTCTTTCAAACGTTGTCCATCA
GACTCGCTTTTCTTGAGGCGCTCAGATCTGGAAACCAGAAAGACATATCAAAACGTCAGGAAAAAGTAGAGTATTACCACATCATACGTCTGCCCACCCC
GCGAGATCAACCATGTTGAGCATTCCACAAATTACTTCATCAGTGTCCCGACCTTCGTGATCAGCAGATGGGTTAGATACGTGAAGGAAAGGCAAGCGCA
ACGATGGGGAATACTAGCTTGATACAGCACCTTGTTGGAAAACATGGATTGTGAAAACAGTGTGGGAGCGTGACGATACAGCGTTCATTTTCGTTTCGTG
TGTGGACCGCAGTTTTAATCCGCATTGCACAATTGCATCAACCTCCTCCTTGGAGGTTACGGTGACCATCGACAGATCTTTCACGAAAACTCTACCTTGG
GCATCCTCGTGAATTTCATAGTTTGCTATGGGCAATAACCCCACAACAAGTCAGGATGAGCAACCGGAGTCATGATGGTACTGCGCACCTTTCTCATAAT
CGTAATCTTCTTCAGTTTTTGGTGGATTCGAGCTAAAGCTGCTCTCGGAGTCACAACCTAGGTTAGAATTTTGAGAAGCATGGATCACTTTACAAGTCCT
ACCTGGTGGCACTCTCGGTCCGAGGaatctgttgctgttgttgctgctttaTCGTGTTGACTGTCAGGGACTACCAATCTGTACGAAAGTATGGCTTTCA
ACTCACTTGACGAAGATACCATTCAGCACTGCTAGAAGTCTGGTACGATACTGGCCGCCCTACTTTCTTGAGATAGCTACAAAATTTGTCAGTAAAGCAC
CAGGTGGGAAGCTCTTATTTTCTCGACACTTACGCTCTTGCGAGATCGCGGACACGGTCACAGTAGATTTCCAGAAAACTGACGACGAGAGTTACTTCCT
ACGCAACAAAGGGTACCCGCCAGTATTCGTGAAATTGTGGTTGAGCAATCGAATCTTCACTCGATGGACGCACTTTGGATTTACTTTGTTGGCGATTAAC
CATGTCGAAGAGATATTCAATCGATCGAGACAGTAATCCTGCTTTCTCTCCACCCGGTTCACCAAAGATGCTACACCCCAatcagcagcaccgtcaaatg
tattttttttcttgcTGTCACTATGGCGATAAAGCAAGAATCAGCGATTGCAGTAGATTACCTGAATGTTTTGCCAGACCCTGTTTGTCCATATGCAAAA
CAGCAACTGTTGATGCCCTTTAATGCGTAGTCCACCAAGCATTTACTCGTCTGGTACAGAAAGCAAGAATAAACAGATCATTATCAAACTAAGGTCAATT
TAGCAGCATTCCCCATGTTGTACCGCTTCGAACAATGTTTCTTGAGTTGTATCCGTCCAGTAAATCTATCGTCAAGCATGGATTCAGCGAAACAACCAGG
CCGAACAGCATTCATTCTGTACattgtcgaagctgaaggcgtGGTTTCCGTATTGCATTCGCTCCGTGTCCTAATTTACAACGTGTTAGAATACGATGTT
ACCGAGCTCTGCGGAAGGCAATGATACGCACCTTGATCACGATATTGCTCGGCGTCTCCTTTTTCCGCTCAAACATGTCTTCGGGGGCATCCTGACCGTC
AGCACAGGGTCTTGCGCGAACGTACACCTGACGGGATCAAGAGATGGGTTCCATCACGGATGTCAACAAATTCGTACCGCAAGATCTCGTTCTACTTTGT
CTATTACCTTGACATTCGCGTTCCCCAGCAACCGAGTGTAGTCAGTGGTGACCTTGTGGTCCATGACGAACGAGCCAACGCAggctcttctccttctctt
tgcTTAGTTTATGTAAGTTTTCACTCGAACGAGGATATTTTCAGCCAGCGTTTCGCGGTGTGCCCTCTTGACGTCTCTGTTACCACCACCATGGGGGCCG
CGCCGAAGAACTCAGTCGAGTACCTGCACGATGTGCTCGCACGTATCCGCAATCTTTGCGATACAGCGTCCAGGGATGGCAGCACTAgcaagcaccagca
gattCGAATTACGCATTGGGTTCGCAAGCTTCGCAGCCAGCCCACGTCGAACCCCACATGGCTGAAAAGCGTACTAGAGTATGCCAGTGTGCTGTTTCAA
ATGCTCCTAGAAAGTGTAAGTGTGCGAAAGCTTTGTTCTTGTTGGGAACGCCAATCGTTGGCTAAACTATTGTCTCTTTCAGGTGGTTGAAGAGCCCTTT
ACGAAAATGCCACCAACAGGTCCGTTGGCACCACTTCCAAGATATCAGGTACGGGCAAACCAGCTACGATTTTCATAGTTAACAACGCTAACTGATTACT
TAGGTTGCAAGGCTAGCTAAGACAGCAAAGCGGATCGTTAAAACGTCGAGATGTCGAGTGCGGTCAACACAACTTGCAGGTACCGAGTCACTGACACCAA
CTAAACACACCCAATACAATCAATCGGAAGACGACTACCAAGCTGAAGCCGAGGTTCGAAAAGTGAACAAGCAGATCCAGACTCAAGAGCAAGACGATCA
GTGGGAGTGGCAGCGCGTCTGGAGAGGAGCTTTCGATAAAATGCatcagcagctacagcagaaaacggaggagacggaggcgctggccaccGAGAACAAG
GTGCAGTCGCTTATGTTATTATATGTCGCCTCAAACGGACTAACTGCTGCGTTTATCTAGGAGTTGCATGCTCTCGTAGCAGGGTATAAGAAAGCCCTCG
AGGAAGTCGAGCGAAACCAACGCGACGTCGAAGCCAAGCATCAGGCCGAGATCGCAAACCTTCGAGCTGTCCAGTCGCTCGAACTCTCAGAAGTGCAAGC
TCGACATCGTCAAAAACTGCAAGAATTGGCACTGCagaacgacgagaagctgctgagcagaAAGAGCAAAGACATCGCGGCCAACTCGGCCGACTTCCTC
CAGTATATCGACGACTTCTACTCGGCCACTTTGCACCTCACTGCACAGAACAAAGTTTGACTTGAATAAAGTATTGGAACTTTCGTGAATTGGGTCAGTT
TTGCGATAGAAATAAGAGGCATGGCGACCAAGACACTGCAGGGAGATCCGCGCCGCCCGGGCGACTTGCACCCGTTCGTGCGTGAGCAGGTGGACCCCGA
CGACGCCCCCGGCGACTGgtacgccttcttctcgctcatcCTGGGCTTCCTCGCCTTCACCATGAAGGTACGTATGTCTTTATTTCTTACTGTAGCAACG
GCACTAATGCTCTCCTTGGTGTATACTTCGTCAGTGGAAGGAGCTGGCTTGGGgctcactgctgctgtgcgtggGCTCGTTCACCAACATGAAGTCGCAG
GACATGAACACGACGCAAGTGGCcatgtccttcttcttctccacctccgcccTCGTGTCCGCCTACATGGGCGCCATGCGTCCTGGGATGCCCATGCCAT
CGGCCCAGACGGTGGAAGCCCCCGCCTCGTAGAGAGAATAGGGAAAGT