Description :
From Genome Similarity Track
Location :
Scaffold_1308:820- 4213
Sequence
3393 bases(100 bases per row)
TACAGCTTGTTCGCCCGCATGACTTCGAACACACGTCGAAGGTGCTGGAGATGCACCTCCATGGCCGTCTGGCCTGCCTCGGCACGGCTGTGGACGAAGA
TGTCGTCAAAGTAAGTCTGTGTGAACGCACGCAAAGGTCGGAAGAGTTGTGTGACCAAGCGATTGAACGTTGCCGGGGCGTTAGAAAGCCCCTGAGGCAT
GACCAGCCACTCCCAGAGCATACCGCTCGGCGTGCTAACAGCCGTGAGTGGGATGTCGCTCTCGCGCATCAGGCTCTGGTAGTATCCGTCCACCAGGTCC
AGCACGCTATACAGCGTTCAGCCGGCCATGCAACACGGGCGGGATCGGTGTCTGCGCAGGCATTGTCGCGCTGTTCAGCTTGTTATAAGCATGAACCAGA
CGCCACTTTCCGTTCGGTTTGCGAACACAAAAGGTAGGCGTCGAGTGCGGGGACTTCGACTCCCGCACCATGCATGCCTTCGCCTTGGCGGCAAAGAAGG
CATCAATGACTTCACACTGATCCCGGGGAAGAGGCCATTGCCTCGTGACACAGTACTTCGTGCCCGGCACGAGATCGATCTCGTGCCTGATTCCCCTGTC
CGGAGGGAGATTGGACGGTGGATCCTTGGACACCACGTCCTCAAACTCCTTCACCAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGCTTGCCACAGCCGTAGCAGCGAATGTCGCTCTGCTCGGCCATGCCCAGATCCATGGGAACCGGCCCGTTGATCGC
TCCATTGCCTGAGTTACCATTAGGCGCACCGCCAGAGGCAGGGTTGCTCTGCCATAACGTTGCGGGGGTACGAGCCTGCTTGTGGCTGTACTCCTCCTGG
AGGGCGATCTGAATCGCCTCCTCCATAGTGTTTGCTGGCACACGGAACAGTTGCGTGCGGGCAGGACCGACACGCAGACCACGGTCACCTTGATGTGCTC
AGGCAGGGGGTTCCCCACCGAAGAGGCAGTGAGCACTCGCATCTCCTGGATGTACTCATGCAGCTCGCGCCTTCCTTGTTTGCAGGCGAGGAAGCGCGAA
CGCTGGCGGTACTCGTAGTTCGCCGGAAGAAACGCGGTGCGCAGCTGCTCGCACAGCTGGGACCATGATGCGAAGCATCCAGGCGTCGTCGCTTCGCGCG
TATACGCCCAACTCTTAGCGCGACCACTAAGGTTGGAGAGCGCAAAGGCGACACGGAGTCGCTCGTCCGAGACGAGAGCCGCGTCCATCGCGAGCTCAAC
CTCTCGAACCCAGAAGTGAAGGTTTTCTCCTTCCTTCCCTTCGAAGGGGTGAACCTTCAGCCGCAGGGGCTTCGGTTGCACCGGCTTCGGCGCGGCCGCA
GTGTCCTGCAGCCCTTGAACCTGGGCGATGAGCCCTCGCTCGTAGGTGTCGAACGCGTTGATACGCTCAACCTGCTCAGCCGGCGTCGCCGCCGCTGAGC
TACGCAGGGCATCTGTCCCAAAGATGCCTGCCATCTTACGAACGGACTCGTACTGCGAGTCGTTCAGATGGGGAAACTCCGTACGATCCATCT