Description :
From Genome Similarity Track
Location :
Scaffold_792:820- 2038
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_792-snap-gene-0.4Gallus gallus hypothetical LOC424466 (LOC424466), mRNA.

Sequence
1218 bases(100 bases per row)
TCCTTCTTATCGCAATCGATTCGTTGGTTAGCTCGACGCTATGTTCGCCACGACTAGACTGCAACTGGAAGGAATCGACGCGCCCGGACGGAGGGATTGC
ATCACGGGCATGATCCCTCCACTCACCTTGGGTAGCCGTTCCCGCACGGCAGCAAACGACTGCCGCTTGACCATCACGGGACCACCACTTGTGCTTTCTG
CCTTCGTTGGTTGCTGCCGCCGTTGTTCGTCTTCTTCTTTCTCCAATGTCCACAGCTGCGGCTGCTTGACCACGAGGAATTGCTGCTGTGGACCGACAAT
GCTTCCTGGACGACAGATTCGACACCACGCGATGGCCTCACGGGCCGAGAATCGATACTTCTTCATAAGGTACGCGGCGATACTCGTGCCCGTACGCCCC
AGTCCGGCCTTGCAGTGGACTGCTACCGCTCCCGACTCGCGCTCACATACCTACCGGTCCCAAGCGACATCGTGGTCAGCAATACACGTGGACAACTAAA
AAGGTTCCTCGTGCGACTCACGCGAATAAACTTGAAGAGGATCTCGTCGGTCGGGTTCCCGCCATCGGGATAGTGCATATCGAGCTGGCCATTTCCATCA
TGATTCGTCAGAGACCATAGTATGAAGTCAGCGGAAGAACCACGTACATGGCGAATGTTGGCGTGGGTGAAAGCGCGCCGATCGTACGTCGTCGGTTCGT
TGAACCGCACGACGCACCCCACGCCCAGCGTCGTAAAGAGCTTGGCGTATTCGTGGGCAAGCAGCGTCGTCCGGCCGTTCCCATCCAGAATCACTCGCTC
ACGTTGCGGGCCACTGAACGCGAGCAGCTTGCCGGGTACTATCCAGTTGATATCACCATAATGGAGCTTGTCGTAGTGCTCATATTCGTCAAGGCGGAAA
GTCTCGCAATCGAAAATTGATGCGCGCATCGCCTGCTCTACGAATACAGGCGAGCGGATTAGTCCATGGTACGCGTACTCTCACAGACCACGAACGATCG
TAACACCGACCTTGTAGACGGCACATGCACAGTCAAAGACCGTGATGAAGTACGAGCACAATCCGCAGGCGGCATCCCGGAAGCCCTGGGCGGGGCGGAG
AGATCGGAACGGAGCGATCGCTTCTCGTGGCGTTTGCTTGTGAACTATCACGAGATAGAGAGTGAGCAGCGCCATCGCGTTGGCTCGCTTGTGAGGGTGG
TCGCTGCTGAGCAGGAGC