Description :
From Genome Similarity Track
Location :
Scaffold_832:82- 1769
Sequence
1687 bases(100 bases per row)
CCACTCACCGGAGTACGTGCCGTCCCACTATCGTCATTTACATCAGTCAATCAACTCAGATATTCCGATGGCCAGCACACTAAATGACTCAGTCAGTGGC
TCACACCGATAGCGCTTTTGTTGTCTAGAAAATGTGGTTTTATAGCTCTTCAACGCTTTACTAGAATCATTGCGCGTTGCGCCTAAGATCTTAGACCTCT
AACCCATGGACCATGGCGTTCCAGCCAGACCATACCGAGAATGAGATCATATATCGAGTCCAAATACAGGACAAGACAGCGTTCAATGCTGTAAAAGTCT
AAAAACTTTACACCCAAGTTAAACGGAACTTCAGGGACGGTGACGCGGGAGCCGGTTGCTAGCCGCACCGTGATAAAATCATCTTCTTGCGCTTTCAGTG
CCTCAGCATACCGCTGAATACTTTCAAGGGAACGGTGTCGGACGTAGTTGCCCGACACCCCAGAGTAATCAGAATTGACTACGGCTTTTCAAAGCCCTTA
CTCGTTTCCAGGGCAACCAACAAGGCTGACTTGTATTCACGCCTCCTGGTAGCGTCCACGAGATCGTTTGGGACTAAGCCACGTTCATCTATACCAATTT
GCACCTCTAGGAAGTCTAGTTCGTCCCCAGTAGGTGCGCGGCGCGCCTTCCTGCTCCGTACCAGGTATCTGGTTTGGGGTGGTATTACGACTCGGCTGGT
TATATCGCGGTCTACGCAGTGGGAAGTTAAAGCGGAGATGTTTGCGCTCCCAAATGTGTAACATCTACGGATGTTACGTTGCTGTTCCACATCTTGAAGG
TTGGCTTATTTATCCGCATGACTAAAATCCATGGGCTCAGCCCTGTCAAACGAGTTCCGGGCGTGCCTATGCGTACCGTAGGAGCAGCTTTTACGTTAAA
CTCGGCGTTTAACGCTATGGTCACAGCCTCTTAAAAGGTTGAGGTATGGACGCGAAAAACCTCGGTCCTAACGTCTTTAGTACGAAGACCTTCAATAAAA
ATGGTTACGTGGACTTCCTTGGGGAGAGGATCTAACTGCATAAAACTGAGAAGAGTTCTCAACTCTTGGACAAAGCTCGACAACTCCTTCTTACCTTCTC
GTGAGGATAAGGAGCGTGAATGCACTCAATATGCCTGATTAGGCGGTGAGAACAAGTGATGCATCTTTATCTCAAGCAATCCCACGTCAGAGCCCATTAT
CTGGCCCTGACGCCAAGTTTTGATATGACCAGGCCAACTTTCTACTGATCAGTTAGAAGCATAGCGGCGCTCATCGTCATTTCAACTTTCCGAATACAGA
GAAGGAGGTTTCTACCACTTTACCTTCGAACGACTTTACGCTCATAACGAGAGGCAAGCCTTAGGCTCCTCACCGGCATGATAATGTAGCGTGCTGGCAT
AGCCGACGCTATATGGTCATGTACCTGTCCGGTTTCATTGGCTTCAAATTGCATAAAGGCTTCCAGCCGCGCATTAAACACTTCCGGGCCTTCAGCCACA
ACATGATCGACTTGTTTGACCCTATCAACGCTCTAAGATTATTAAGAGCGAGGCGTTGCGCCTCAGAGAGATGAGCCAGACTTTTCATCTCAACAGAGGA
TTAGTCGTTTTGCGACTACGGTGTAGGATTGACTACAAGTGTTACCAAGTAAATCGGGGCTACACAAATCTTAGTCAGATGAAGATT