Description :
From Genome Similarity Track
Location :
Scaffold_3598:82- 1522
Transcript NameFunction/comments
Phypl_g15928reverse transcriptase

Sequence
1440 bases(100 bases per row)
GGCGGCCATCAAGGCATCGGCCGGACGTATCAGCGGCTGCGACGCCACTTCCACTGGCCGGGCATCTTCCGAAGCGTACAGCGCTACGTAGGAGAGTGCA
CAGACTATGAAACTGGGAAGGGTCGGCCGACGATCCAAGGCGAGTCGCCGGGGAATATCGTCGCGACCTACCCGTTCCAAGTCCTGGCGATGGATCAAAC
CCCGTCCTTGCCCGCGTCGCACAAGGGCAACACCGAGTTGCTCGTCTGGGTGGATTTGTTCACGGGGTTCGTCGTCGCGAAGGCGAACTTGTCACGAGCG
GCGCAGACGGTGGCCGAGGCGTACGAAGAGGCCGTCTTCCGGCGGTTCGGCGCGAGCGAAGTGGTCAGACACGACCGGGAGCCAGGCTTCATGTCCGACT
TTTTCAAGGCATTCAACAAGCTAATGGGCCAGCGACAACGGGCGACACTCGCCTACCGACCGCAGGCGAATGGCGCTGCGGAACGCATGGTACAGACGAT
CACAAGAGCGATTAAGATGTACACCGAGGACATTGACCAGCGCGACTGGGACGAGTATGCGGAAAGGCTTACCTTCGCGTTGAACACGGCCCACGATCGC
ACGAGGAATGAAACCCCTTTCTACCTTGTGCACGGATGGGACCCGAGATCGACACTGGAATCGACGCTGTCTGTCGGCAACACGTCTCACCGCGAGACTG
aggccaggcgctggcgatTGCGGATCCAGAGGCACTACAAGATcgcacgagctcaagcgtTGGAGTTAGTCCGAGAGGCAGTCGAAGCGAGAGCACGTCA
GCAGAACGAGATCGCGACGGAACACGCGATTGAAGCCGGAGGACGAGTGTGGCTTAACCTGGATCGAGTAAAGCCGGGGTACGCGCGCAAGCTGGCGCAC
ATGTGACATGGGCCGTtccgcgtcgtcgagctggtggacacgTACGCCGCACGACTTGAGACGAGCGGTACGCCTTATCAGCTCTACCCGGTCGTGCACa
tctccaagttgaagcccgTCCGGGAGTTCCCGGCGCGCCCGGCGATGCCACTGACGGTGCCGGCCGGTGAGCGTTTCGATTTTGATGAAGAGCTCTTGCC
AGAGGACAGCTGGGAAGCAGAGGAATTGGATGATGACACCTTCGAGGTCGAAGAGATCCTAGACATGCGCGAGGGTCGAGCCACGCGATATGGCCGTACG
CGGCGCGAATTCGAAGTGAGGTAGAAGGGTTACCCAGACACAACGTGGGTCGATGAGCTGGACCTCAACTGCGGCGGAGTGCTGTGCGACTTCTTGAGAC
AGCGCACGGGGCGCAACCGGTTCGCCGTGACACAATCGCGCGAGAACGCGACGGCGGAGCCCGACCAAGGTGGGTGAACGCCTTGATGGGTGCGGTGAGA
GTCGGCAGGGGGGCTGCCGACGGGAGAAATGGTGGAGACG