Description :
From Genome Similarity Track
Location :
Scaffold_23:82- 1420
Transcript NameFunction/comments
Phyca_LT1534113001serine protease family S10, putative
Phyca_LT15345343543ketoacylCoA thiolase putative

Sequence
1338 bases(100 bases per row)
ggacgagattatctgcggtgacactaagaatgaggctgggtacatcaaactacctaacaagaacgatgaccattacttctactgtttttttgaagcaaaa
tacaatgtaagtacagctccgttggtgatttggttgactggtgggcccggtggatcaagtttactggcgttattcagcgagaatggcccctgccggatcc
aaccagacctcacaacgaaggtgcatccgtactcttggacgtacgaggcgaacatgatttggctggatcagccgaccaacgtgggcttctcttacagctc
aggcgatgaccacgactacaacgagaaggacgtaagcgaaaatttgtactggttcctgcaagggtttattaagaaacatccagagtttcaaggacgggag
tttttcttgacgggcgaaagttacgcgggccattgccttccggcagtggcaacctccattttgcagaaaaacaaaaggctgaacgggtccactgctggaa
cgaagcacatcaatctgcaagggatttctattggaaacggatggacagaccctgttatccaggtacagtacttacggccttacatattgagactgattct
tgagtattgacgctgttgcctgtagtattcccatgttgcggacattcttgttaacaagtacaacgttacactgcttgagggttcagcagctcaagagttc
cgatccaatgctgccaaatgcgccgagtttactattcagtgccagcaaaacccgacgatcgcttcctgcaccgaaccattcgagttttgtagtgataccg
ttttcgacgggctatcagctaatgtcactggccggaacccgtacgatgtgagagaaccgtgtgactccgtagagtttggcttttgtggtggagttccact
gactgaagctttcctgtcccaaagtgaagtgcaagagtatctcaacgtcaaccgcgaatggatcggaggaagcgaggaagtggacgagaacttcattgtc
gattatctgcaatcgttcggtggtaacgtcgcggttctgctgaatgaaggaatccacgtacttgtgtacgtgggtgacgcggacagtgtgtgcaattggg
caggcaacaatgcttgggtcgacgccattgagtggaaggggaaggattcgtttaataccgcggaggagaaagcgttcatgacaagagacgtattcaaccc
gaacgctttgacagaagccggtactgtcagatccttcgagaatttggctctggtgcgagtgttcaatgctggacatatggtccccacacaccaacctgaa
gcttcattagacctcatcaacaagttctttaagaacga