Description :
From Genome Similarity Track
Location :
Scaffold_4296:82- 1305
Transcript NameFunction/comments
Phyin_T30-4PITG_22605Putative uncharacterized protein

Sequence
1223 bases(100 bases per row)
TTGTCTGGGCAGTGGATCGTTGCCAGAACTAGACCCTTCCATGGTGAAGGGGGTGTATGCTTTAATTGAGAAAAACAAGGTAGGCCGCGCTTGCTAAATA
TTTGATAGTTATGTACCGACAGTGCTTTGTGAAGAAACCCGGTCGCTCTTCTACTCGACGAATGATGGTTCTTCTCGTAGCAGCGCTCTGTAGATGCCAT
CCAATCCAGTCAGCAAAAATCCTACCACGGGTTTTATCTTACACATGTCTTCGTCTTCGCGACAGACACGCAAAGACAACGGATGCATGTGTGATATTGG
TGTCAGCCGTTGCCTTGTACGTCCTACCGTGCCCCACCGTATCGCTTCCTGATACCGGGAACAGTGCTGAGCAGCGGTTTGAAGCGGTAGCTGCTGTGTT
CACGAAGGAGACAAATGCAATCGGCGAAGCAGCCACGAGATGTCTCTGTGCTTTGCTTCACCCCGTAGATTTTGATGGGGTATCTGTACCAGGTCCCAGC
ACCATTCTCGCTCATGCCACCCGGATACGTCCATTCTTCAACAGTTTCTTGGCTGACGTTGTTGCGAAGATAGACGGTAGCACGATGTTTGCTACCTTTT
CACCTTTGTTTCTATTGCTCCAGTCAGCGTGCCAGCTAGCTCGAGACGCGCATGAAAAAGGGTCTTTGACTGGGCTTGGTGACGACTTTTCTCCTTACAT
TGGATCAATCTTCGAAGCGATAGAGGATTCCTTTCAATGCGGCCCTCGTGACAACTGGGTGCTGAGAAAACGTGCAACGGAACTGCTGACTCTGATGCTC
GATGTATTCGTTCTGCAAGAGTCTGCTTGGTGCTCCTCCGTTCAAGTCGCAACAGAGTATTTTCAATCACAATTGGTACGTAATCTACTACGTAGATAGA
GTGCGGGAGCCTTTACTTGTTGTCAACTATCATTTCAGGAGCGAGTTCGGACTCTCGTGCTCGCAGGTCGCCACGATTCAGTCTCAGTTGTTCGCGAAGC
TGCTATCCCTGCAGTCAGGGCTTTTGAATGTCTTGAAAAGCTGTGTCCACCAATGAGTGGTAAACTCATGTCAAGCGCGAGTGCTACTAGCTACGACTTC
GCTCCGCCCAAACCACCAGGTTACTCGTTCGCTAACAAGCGTTGGAAACCTGCAGTGATTAGTGCGCACGACTCTGATAATCCCAAAGCGAAGTCAGATC
CGAGTTCCTTGTCATTCGAAGCG