Description :
From Genome Similarity Track
Location :
Scaffold_96:81992- 83897
Sequence
1905 bases(100 bases per row)
TTGCACATTTATAGCTTCATTACGCTGATATAACTAGGCCATTAACTGATCTCCTTACAAAGGACACATGGTGGTGATGGAATATCATTCATACTAACGC
GTTCCAACAGTAAAGAAGATTTTCCTCTATGCTCTCATTTTAGCGTTAAATAATCATGAGTACCCTTTTAGTGTCGTCATGGCGCATCTGACTTCGCCAT
AGACAGCGCCCTGATGCACAGATATGCTTAAGTATTCGAGCGTGTCATTGCTTTTGAATCTCGTCAGCTCAGAGCTGCTGAGAAAAATTATCCAGTTCAT
GACAAAGGGTTACTTGCCATGTAGTATGCTCTCGAAATTTAGTGTTTATCGGCTTGGTTCCAAGCTATTCGTCGTCTATACGGATCATGCGTCGTTACGC
ACGGCGACAAAGTCGTCTCACCTCTCTCATAGAATGTCCCGTTCGCTTTCCTCCTTTGCGAAATATGACTTCGAGGTGAAGTATATGCCGGGAAAACAGT
GCGTGCTAGCGGATGCTCTCTCTCGCTGACCTAAATATCAGATAGCTCATGGTTACGACCTTGTCGGCTCCGGTTGAGGATTTAATTCGTGTGACATATG
CACGATATCCATAATGCGTGTCATTGCTCCATGCTCTTAGAAGCGACGCTTCCAAAGACTCGGACATTAATTTGTCGGCACGGTTAAGTGCCAACCTAGA
TCGACATTATATCTATCGCGGCCTCTTGTGATATTGCATGGATGTAGTCGATGATCCTCGCATCGTCGTGCCTTTGGACGAGAAAATAAAGTATCGAATG
CTTTTTGAGGCCCATGATAATGCTCTCAGGGAAAGTTTGGGCGAGAGAAGACTTAGTCTCTGTGAGTCAACACTATAGTGGCCCAAATTATACAAATGGA
TCAGCACATACGTACAAACGTGCGAAACTTGTCAGCGGGTCAAACCCTCTGCGCACTCGGTGGCACCGCACGCTAGTTTATCCGTACACTGGGTGTTGGG
AAACCATCAGTGTGGACTTTGTGTTCGGTCTTCCCAATACAGCGACGACAATACAGGCATCGTGGTCTTTGGACAGTCTGAGTAAAATGACTCACTTAGC
ACCGTGCCCGAATCAATTGAAGGTATAGGTACAGCTATGCTTTTTATCAATCGTGTGTTTCGTCATCATAGGTTGCCAATGCCAATCATCTCTGTTAGAG
ATCCTCGCATCGCAGGAAAGTATTGGACGTCCATATGCAAGGTGCTTGGCACACAATTAAACATGCCTACTACGGATCAACCGCAGACCCATGGGTATAC
TGAGCGAGTTAATCGCGTCGTCGGCGATGTCCTTCGCATTGTTTGAGCTACATCAACTAATCCTTGGAGCTTGATGATTCCTGTCGTTGAATTTGCGTAG
AACAACGCCATTTATTCCTCTACTAGAGGAACGCGCGGCAGTGTGAGACTATGCACATAGAATAGCCTCACAAAGCCGCGCATACCGCTCACCCTACCGC
TGCGTGGATCCGGGCTTTGTGGGGGAGAGGTTGCCGACAAGCTTGCTGATATCAGCCCTACCACAATGCAGCAATACGCGAGCGAGTTTCTTGCGATGCG
CTTTAGTGTCTTATGCCATGTGCGTGATGAAATGGCTGATAGTCAAGATAAGCAAAGGAACAAGCTGGTGCTGAAGGCAGCAGATAAATTGATTCTGATG
AAGTTAAAGAAAAAGTCTTAGAAAACGATAAAACCCAACCTACAAAAGTAATGTCTGCTGTATTCAAGACAAAGTTGCTTCCGCGATTCATAGGACCGTT
CACGGTCGTAGCTAAGAAAGGCTTTGCCTCTACGCTGAACCTTCCGCGTAATCTACGCACACACCCAGCTTTTACGCTGCTTGTTTAACTCGTTATCATA
ATCCT