Description :
From Genome Similarity Track
Location :
contig_57:81977- 83517
Transcript NameFunction/comments
g8897.t1L-threonine 3-dehydrogenase, putative

Sequence
1540 bases(100 bases per row)
GCACAAGCTGTTCGAGATGGCAACCTTCGCGCAGTCACTTTGGGAGCACTTGGTGCCGCCTCCATGGGACCAACAGAGACCGCGCGACTTGCCTCGCCGA
TCGCAGCCCTCCGTCAGACACTTCACCCAGCCACCTACGACAAGGAGTTCCTTGAACATGTGCAGTAGTTCAAAGCCTGGTGGTTATCTTACCGTGTTTC
CAGCACAAGCCCGCATGCTTGGCACTTGATCGACAGCCTTCAGCTGCGCATTTCTTGCCGCCCTGGACGAGGAGTCACAGCAGACGACACGCCGGTCATG
CCAGGAACAGAAACACACCCGGTTGTCGAGACGTACTTACCCCGTGCCGAAAGCACAGCCTCTTGTTGATGATGTAGTTCTCGCAGCCGTCGACCTTGCA
CTCTCGAGCTCTGCGCTTCTCTTCGGTCGCTGGAGATCGTGCTTGTCTTGACCTTGCAGCGGGGGTCGATACCTCTTGATCAGGAACGGGGACATTCTCG
GAGCTGTTCATGATGAAAGCCACCGACGCCTTGCTGCTGGTCGCCATTGCACTCAGCTCGATCGACGTCTCTTTGACAAATGGATTCCTTGCGTCGAGCT
GGGCGAGATCTCATTCCTGCATCAAGCTGAGGCCGCCGGGAAGCGTCACTTTAGGTAGCGAGCGAGGATGCAACTGCTGACCAAGCTGCTGCCACGCGGG
CCGCGTCGTGTTTCACTGTCATATATTCCGAGGAGCGTGTTATCTATTGAGCTATCTTACGCTGTCTCCTCGACAGCTTCGGGCTTGGAGAGCTTGGCGT
CGAGCTTGACGAGCATGTCCTCAACCATGCTGTCCAGGTCAAAGTCGTGCTGCCAGCCCCAATCCCTCCGGGCGATGCTGTCATCCAGCGAGCGCGGCCA
CGTCTCGGCGATCTGCTGGCGGAAGTCGGGCTTGTAATCGCACTGGAAGCTCGGCATGACCTTCTGGATGGACGCCACCATCTCCTCGGGTGTGAAGGAC
ACGGCCGTGATGTTGTACGTGCGCTGCGTCAAGCAGTCGTTGGGTGCGTTGATAAGCCCCAGCGTGGCCTTGAGGCAGTCGGGCATGTACATCATGGGCA
GCTTGGCGTCCGGCTCGAGGAAGCACGTGTACTTGCCGTGCTTGAGTGCGTCGTAGAAGATCTCGACGGCGTAGTCCGTGGTGCCTCCGCCAGGCAGCGC
CTCGGACGAGATCACGCCCGGGTACCGCACCGAGCGGAAGTCCACGCCAAATTTGTTGTGGTAGTACTCGCCCAGCAGCTCCACGTGCACCTTGGTGAGT
CCGTACATGGTCGTGGGGCGCATGATGGTCGTGTCGGGCGTCTCGTCCTGCGGCGTAGAAGGCCCGAAGACTGCAATGGTGGAGGGTGCAAATACCCGCA
GCTGGTACTGCTTGGCCAGCTCCAGCACGTTCTGGATGCCGCGCGTGTTGACCGCCAGCGCCAGACTCGGGTTGGCCTCGCCCACGGCCGACAGCAGCGA
CGCCATGTGCACGATCGTGTCCACGCCCTGCTCCGCCACG