Description :
From Genome Similarity Track
Location :
Scaffold_37:8196- 12320
Transcript NameFunction/comments
Physo_344937Eukaryotic/viral aspartic protease

Sequence
4124 bases(100 bases per row)
CCACCCATAGCCACAAGCTAGCACGGATCAAGGCCGATAGCGGCGCTGAAAACGAGCGATGACCCAGGAGGCGGAGGCGGGGATCGAACCCGGCTGGCCG
GCGATCACACAAGAAGTGATGATCATCTACATGACGTCAATCTTCAAAGTGATGTACGAGACGACGGACAGCACGAAGACCAAGATGGGCGTCTCACCGG
AAGAGCTTGCTCGCGCCACAGTAGAACAGTGCTTCAAGGAGGCCGACCTAAACGGTGACAACAAGCTCAGCTTTGAAGAATCCAAGAAGGTACGAATGTT
CGATTTGTTGCATCTCCCGTGTGTTGCTGGCTAATGGTATTGTGTGTTTGTTCGTTGTGATCTGTAGTGGTGCACTTCAGGAATTTGAAAAGGCCACACT
AATTCGGAGCTTGTGAAACTAAAATGAATGCATTCGTTGCTGAACGGTTATCACGGTAACGGCTGGTCACGAAGCGCCCGGCCAATACACATGTGCTGCG
AGCGAGTACGAAGGCGAGCCACCAAGCGATTTGTCTGACTGGACGATCATCGATGACCCCGGGCCCAAGCCGCCGAGTCCAAGGCTCGAAGATGAGGTCG
ATGTGAGCGACGAGCCATGTCGTCAGACCCGGAGGAAGACCTGCGCTTACGTTACCTTCTGGCAGCCAAGTACGAGGAAGAAACAGATGGTCGAGGCGAC
TCGGCGGGAGACTCAGCCGAGTTCGAGCACCAAGCAACGAACTTGGAGCTCGAAGACTATGCTCGCGAGTTGGCGTTCCTGCCCGATCTGACTGAAGCGG
TGTCGACGCCACTCGACTATGAAGAGCCAAACGTTCGGAGCTCGGCGCACACTCGGCCACAGTCTACTCGGCTGGTGGAAGTATTGAAGAGCCATGAAAA
GATCATGATCTCCAGTGGTAATGCCCTACCTCCACCAGCATACGGCGTAGTGTGCGACATCGACGTACAGGGGCATCCGCCAATCCGCCAACGAGCCCGC
CGAGTTCCGCTGAAGCATCTCGGCAAGTTGTACGAGCTGCTCAAGGCGCTGTTACGAGCACGGCTAATCGCCTTCTCGAACAGCCCATGGGCATCGCCCA
TCGTGATTGGCCTAAAGAAGAATGTCGGTTGTGTATCGTCTACAAGCTGGTAAACGCGATTACGTTGCTCATGGAGTACGCCATGCCGCTAGTGGACGAT
CTCCTCACGGAGTTGGAAGCGTACCTATGGTTCTGCTCTTTGGATACTGCCAGCGGTTCTGGGCGGTCATGATGACTCGGCGTGCGCGTTGGATCCCGGC
TTTTGTTTGTGCGCTTGGCCACTTTGAGTGGCTGCGGATGCCCTTCGGATTAAAGAATGCCCCAATGATCTACCAGCGCCTTATTGACAACGCTCTATGG
GGTTACGTACAACCCAAGGGCGGCTGGAAGGTGTTCGCCAAGCGTATCCAACAAGCGGAAGCCGCCTCAGAAGCTCAGCGGAAACGTCTCACAGCCGACT
TCGACTTTGAGGCCAGTGGCCAGACCAAGTTTGAGGCTGACCACCGAGCTCAAGCCGAGTTTGGCCCATTGGAGGAATTCATTAACAGCCCAGAAGCCGA
CATGTTCCGGACGGGTGAACCTGATGAATCGTGCCTTGCACCGGTTTTCGACCGGCGAACGTTTGTGGACTATATCTGCTTCGGTGGGAGGACGTTCGAC
GATTGCTTGGGGACGCTTGACCGATTGCTGCAACGCTTCACTGAATGCCGCATCAGTGTCAGCTTCCCGAAAAGCATCTTCGTCCAGCCTAAAGTCGACT
TCCTATCACATGGGGTGACCTCGGCTGGAATCCAAGTCGACCAGAAAAAGATACTGGCAATAGCTGGGTTGCCATTCCCGACGACGAAGAAGGGGTTGCA
GGCGTTCTTAGTAGCACTCAACTACTATGGCCGGTTCATCCAGAACTTGGCCGTATTTGGGGCAGTCCTCTATCAGCTGAAGGACGAAGACTTTGGACCC
GGCGGTGACCTGACGGCTGCTAAAGCAGCGTTCGCCGAGTTAAAGCAGAAAGTGGTCGACGCGCCCATACTCCGCCACTTCAACTCGGCTGAGGACGTCC
ACGTTATGCTATTCGCCAATGAGTGGGCTCTGAGTAGCACGCTGATGCAGCTCCACGACGGGAAGCTCCACCCAGTGCGGTTCTGCGGCCGAGTCCTCAA
GGATAATGAACTCGGCAACCATCCCACCGAGAAAGAAGTTCTCGCCTTGCTACAGCTCATCAAGGTGTGCCACACGTTGCTCGCCGGGAAGACCATCCAT
GTTTACACCCGCTACTCGACTCTCGAATGGGTGTCCCAGTCGAAGTTTCTCTACGGCAGAGCAGTCAGCTTTGCGGTACTGCTATCACCGTTCCACCTAA
AGGTCAAGCGGGTCCGCGAACGGGACACGGATTTCGCCCAGTTGCTCCAAGCGTCCATCACACCGGCAGTGGGATTGGACGAGCTACTAACGGCTGTCGC
CCCGCCGTCCAAGAACTCGGCTGTGGTCCGCATGGACCCAGAGTTGCTGCATGCGCATGTGCCCCGAGACTTCAAGGGGCACGTACTTTCGTTCGACGGA
TCGGCGAAGACCGCTAAACACGGCGGGTTTGGGAGTTGTTCTTGGATCCTGTGGCGTTACCAGACTGGAGCATTGAGATCGTTGCGAGCGCGCACCTCCC
ATCGACCAGCCGAGTACACCGGCATGAACAATGGCGTGACCTCGGCTATTGAGCGTGGGGTGAAGGACTTAATTATCGTGGGCGATTCTCGGCTTGCGAA
CCAGCAATCCATGGGGGTGATCGCGTGTAAGAAGGAGACATTGCAAGTCTAGCTGACACGCCACAAGAAATGGGTCGGCAAGCTGAATTCAGTTCGCTAC
CTACATGTAGTGCGCCTCTACAACTCAGCAGCTGACTCCCTAGCGACCGAAGCGCTGGGGACCAAGGCAGGAAAAGTCGTGCTCAACGCCGAACGGAAAG
CCGAGTTGAAGACCCAGAACAGAATCTCTGAGGTCCTGTACGTAGACACAGACTCGGCAGCGGTCCCGGCTGAAGATACTGAGATGGCAGTCGTGACGAG
GAGCCAAGCTCGCCGAGTCCGTTTCGAAGACGAAGCGAGAGGAGACGCAGTCCAACCAGCTATGAATGAGGGAACAGAACGAAATGACTTCGAGCGAGAT
AGCCGACCTCCGCCTGCAAGGCAACCGGCGGCTGGAGAAGCCGAGTTCGGTAGCACAGCACCGCCAGCGAACTTAGCTGAGCTGGTAGCCAAGCTCGGAG
AAGCCCAGGAACCCAACGCCATGGACATCGACCCGGTGGTGGTCCAAGCTGGGCGCCGTCTACGAATAGCGAAAGCTCAAGACGAAGAACAACGGTGGGC
CGATTTGAAGACCTACCTGAGAGGAGATTATGCGTAGCTCACACATCGCCGAGCTCACAACGCTGGGAAGGTCGCTGACGAGTTCGTGCTCAGCGAGGAC
GGGCTATTGTATCGACAAGACAAGACAAAGCCAAACGACCTGGTGAGCTCGGCGAACTGGGCTTATCCCTTCGATTGGTGGTCCCAACGACCATGATAGA
CGAGATCCTGCGGATCTGCCACAACTCCATCGAGGGAGGCCACCAAGGTATCGTGCGGACCTACCACAAGGTCAGAGCTGACTACTACTGGATTGGCCTG
TACGCGGACGTGGTCAAACATGTCCAGGCGTGCGAGGACTGCAGCACAAGCAAGAGTAAAAGGGCTATTCACCCGATGACGTGGTGTCTGAACGTCCGTT
CCACGTGGTGTCGATGGATTTCGTCATTCCACTGCCGAAGACTCGGCGGGGCAACACGGCACTCTTGCTGTTTCAAGATCACTTTACCGGGTTCGTGGTT
GCAAAGGCGATGAGCGAGACTGGGGCACTCGAGGTGGCGAAGGCTTTCAAAGAGAATGTGTTCCGGAGGTTTGGAGCTCCATCACTGGTGCGCCACGACA
GAGATCTCCGGTCCATGAGCGAAGTATTCCAGAAGTTCTCGGAGATGATGCAGTCCAAGTCGAGAGTTACCGACCGCAAGCCAACGGCCAGCAAGAACGC
TCAGTGAAGACCATGACCCAGACT