Description :
From Genome Similarity Track
Location :
Scaffold_210:8196- 10437
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19888hypothetical protein
Phypa_INRA-310PPTG_19889hypothetical protein

Sequence
2241 bases(100 bases per row)
CCTGGATTTAACCCACGCACGCAAGCACGTCGATTATCCGGAGGAGCATTACTAAAAGCCAGTCATTCTGTATCCGGATGCTTGTCTTCTTCAAACTCGG
ATATCCTTCAGCCATTATCATTTCTGCCACGTACCTCCCGAGGCTCCGAAGTATCCTTTAGATCCCGCCATGTCGTATTCACTATTTCCCCCTGCACCGC
CTAGTGCTCCATCAACATCAGCTGCACCCCCACCGCCAGTTTTTCGATCAACAGGGGGCTTGCAGAAGCTCATTTCGCCCCAATTCCTGTCCCCAGATGC
TCTATTGAGACCGGTTCCGACCAACGAATGGTGGGGTAACTTGCTAGCATGGGACGGGCAGCGGGACAGCGATGCTGTGTTTGCCGGTCCTTACACTTAC
AAGGTGGTGCAGAGCCAACCCGGTACCATTGGCAGTGGCCTCTCCGTCAGCTACTTGGTGCAGTATCGGTCGGACGGGCCTATTAACGACAACGGAGCTC
CTCGCTTCTACTTCTACCCGCCGACCATCAAGAACTGGATCTTCTCGGCTGTAGAGTTGGCAGAACAATCGGGTGCTCCACCTCTTACCATTCAAGCTTG
GGATGACATGGGTGTGCACTTGTCAATGGCGGGGATGAGGATGTACCTTGCCTTAGGTTCGGCCTTCACGACGGTCGAGTACCAGGACATGCAGGTGCAA
CTCGGTTCAGAGCACTCCATTGTGGCTATCAACGGAGCTCCAGCGAGAGAAGGTCACCAAGTGAATGGCATCAGCTTCGTCATCTCGCTCAATAATGGAC
AGCAATGGGTGCTCTACTTCTTCTCCAATGCTGGTGGGAACACCTCACTGGTGTTTGAGGGCAACAAGCTCGCAACGACTTCCAAGTTCACAGGGGTTGT
CCAAGCGGCTTTTGTGTCGACGAGTGCAGTGCAGTCTTCCGTGCCTCAGGACGACCATAAGATCCTTCAACTCTACCATGCCAGTGCTGGCGTCTACCTG
AGGGGAGCCACTATTCAGACGTTTGACTCCGATTCGTTTGTGTTCAATTGGCAGCTCGCAAGCGCTGCAGGCAGCAACCCAGGAGCTCGTTTCCTGCACT
TCGCACTCACACACCTGCAAGATATGCTGGATCTGTCCAGTGTCGAAGCCAAGGACGAGCTGGTGCTGTATTCGCACACGCACGGACCGCTGTTCGCCTA
CCTGTTGACGACTCCGCCGAGGTCCAATCCAACGTGGCTTTGCCGCGTGCCTCAAGCTGAGAGCCAGGGAGTGGAGGCGTGCACTGCGTTCTACCCGCCT
CGTGCTGGTTGCCTCACACGTGATGTGGTTGACAGACTGAACTTGTGTCGTGTTGTCTCCGATGAAATTTATGGAGATTGGTCGCTGCCCCATGAAGGAA
GCTACTACTTTAAAGGCAAGGCGCTGCAGAAGTTTGGCACTATGTGTCTTGTAGCTCGGCAGCTTGCAGATACCACCAATCCAGAAATGCGGGATGTTGC
AGAACACGGCATCTCCAAGCTGCAGCAGTTGCTGTCGCAGTTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGCTCGGCAGCTTGCAGATACCACCAATCCAGAAATGCGGGATGTTGCAGAAC
ACGGCATCTCCAAGCTGCAGCAGTTGCTGTCGCAGTTTGCAGATAATCAATCGGCGTTTCCGCTTGTCTATGATACTGTGTACAAGGGAATCATTTCGAG
CGAAGCGTTGGCCAGGAACGATATGAACGTCGACTTTGGGAATGGTGTGTACAATGACCACCACTACCATTATGGCTACATCGTGACTGCTGCGGCCATG
GCGCTCTACTTGGACCCGAATTGGCGTCACTCAGCCGATGCTGTCAAGCTTCGAACTGTCGTTGATACACTCATCCGAGATGTGGCTACATCGTCTCCTA
TGGGAAGTGATCCGTACTTTCCGCGTTACCGATACTTCAACTGGTGGCTGGGGCACTCATACTCTCACGGCGTGACTCCGATGGCCGATGGCAAGGATGA
GGAATCTACATCTGAAGAAGTTAACTTCCTCTACGGGATTGCTCTGTACGGCCAAGTCACGGAGAATGCAGAGCAACAGGCGCTGGCAAAGTTGATCCTC
AAGGTGTACGTGCGCGCTGTAAACACTTACTTCTTGCTGCG