Description :
From Genome Similarity Track
Location :
contig_108:81952- 83474
Transcript NameFunction/comments
g13154.t1hypothetical protein

Sequence
1522 bases(100 bases per row)
AGGCCAGACGAACCACCGGTCGCTGACCGCAACGACCTGGCCACTGGTCGACAGAGACGCCGACGCCGAACCACTCGTGATGTCAACCAATCCACCGACA
CTGCTAGCAGCGGTAGTCCACCTGCGGCGACGTTTACATTGCCACCGGCGCCAACTGTGCCACTGCCAACCGACAGCGAGATCGCGCCACCAGTGCCTCC
ACTGGTCGACGCACCCGTCGACAAAGAGATCGAGCCACTCGACCCGGAAGACGTAGGTCCAGACGCTACCGTGATAGCACCGCTGGAGCTTGTCGCCGCG
AGGCCATCGCCTTGATAGATCCACTGATGCCGCTCGATGCTTTGCCGCTCGCGAACGTCAATGCGCCGCCAGTACTGCCGCCACCGCCACCGGAGAGCGC
CAGAGCACCACCAGTTCCCGTGCTGCCGCCGGTACCGCCCGTGATCGACACAGCGCCGCCAGCACCGGTGCTCGTCAAGCCGCTCGAGATCGAGACCGCA
CCACCAACACCAGCCGTGCCGCTGCTATCTCCAGCGCTCACAGTGACTTGTCCACTGGCACCGCCAGAGCTTGTTCCTGACACAACTCGCACTGAACCCG
ACGCGCCACTAGTAGTGCTACCGGAACTCACCGTCACCAGGCCAGACGAACCACCGGTCGCTGACCGCAACGTCACCTGGCCACTGGTCGACAGAGACGC
CGACGCCGAACCACTCGTGATGTCAACCAATCCACCGACACTGCTAGCAGCGGTAGTCCCACCTGCGGCGACGTTTACATTGCCACCGGCGCCAACTGTG
CCACTGCCAACCGACAGCGAGATCGCCACCAGTGCCTTGGTCGACGCACCCGTCGACAAAGAGATCGAGCCACTCGACCCGGAAGACGTAGGTCCAGACG
CTACCGTGATAGCACCGCTGGAGCTTGTCGCCGCGAGGCCATCGCCAGTGTTCAGCGTGATAGATCCACTGATGCCGCTCGATGCTTTGCCGCTCGCGAA
CGTCAATGCGCCGCCAGTACTGCCGCCACCGCCACCGGAGAGCGCCAGAGCACCACCAGTTCCCGTGCTGCCGCCGGTACCGCCCGTGATCGACACAGCG
CCGCAGCACTGGCCGCACTGCTCGTCAAGCCGCTCGAGATCGAGACCGCACCACCAACACCAGCCGTGCCGCTGCTATCTCCAGCGCTCACAGTGACTTG
TCCACTGGCACCGCCAGAGCTTGTTCCTGACACAACTCGCACTGAAGTAGTTGCTACCGGAACTCACCGTCACCAGGCCAGACGAACCACCGGTCGCTGA
CCGCAACGTCACCTGGCCACTGGTCGACAGAGACGCCGACGCCGAACCACTCGTGATGTCAACCAATCCACCGACACTGCTAGCAGCGGTAGTCCCACCT
GCGGCGACGTTTACATTGCCACCGGTGCCAACTGTGCCACTGCCAACCGACAGCGAGATCGCGCACCAGTGCCTCCACTGGTCGACGCACCCGTCGACAA
AGAGATCGAGCCACTCGACCGG