Description :
From Genome Similarity Track
Location :
Scaffold_7:819351- 821795
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05273protein kinase
Phypa_INRA-310PPTG_05274hypothetical protein
Phypa_INRA-310PPTG_05275U3 small nucleolar RNA-associated protein 18

Sequence
2444 bases(100 bases per row)
TTAACAGCCCGGAAGCGGCTAAGAGGACTGCCCTTACGAATGCGAAGGCGAATGTGGCCACGTGGAAGCTCAGTGTCCGCACGACGGAGGCCACGATGCC
TCTGCGGACTGGCATGACCTGTGACCTCGTACGGGCCACAGCGACGCGGGGAGAGCGACAAGAAGCACGCGAAATGCGGGAAGAAGGCGATGGCGTGGCT
GAGGCGCTGTGGACGTGCCTGCGGATGCTGAGAGCGGGCTGGTGCGGGGCTGAGTAGCTCCGCTTCCTTTCGAATGATGCCCAAGGTTTTATGGGTTACC
TGCAGTGAGGCATACATTACTCAAGAGATCTGTAAATATTATACCCGTAGAATACGATATGTGATACAGTCAGTATACGTTTGACTTATGGGGATATTGT
AAGAGTAGAAATTTTGAAAGTTTATTTATGAAGGTACCAACCAGCATTCTGATGTTTGCACGTCAGATTTGATGCTCAGTCATCAACCTGAAGTCCAAGA
ATTCATGAATCGCTCACAAAAGAAACAAGTTTGTTTAGTATCGACGTGTATTGCGGAGTTTATCGTTTAAGAGTGCAACGCAAACTGAACGCTACCAGTA
GGTCATGGTGGTGATCCACTCGCCCGTTGGCCCGCTCAAGCTCGATAGCATCGACTATGATTACCGAGCATAAATAATGGTCTTGGGCCGGCGAGGGAAC
ACCACATTACCTGGATAACTTATGATGGACTTGAGTACAAGAGTGGGTGAAGGAGCGCGCGGACGCGAGCGACCTAAACCCTGTAGCACATGTGAGCGGA
ACCAGTCAGTCCAGTTCATGCACTAGATCCTCCACCTTGCGATCTTGTAACACTGTGAGACCCTCCGCCACCTGGAAATACACGTGTACGTGAAAGATAT
CGATGGACCTCTCCGGGTTGTCATCATAGTTCCACCTCTCCACATGCGGTGCGTTGGCATCAATCCAGTTCTCCACGTACTGCTTCACCTGTTCATGATT
CAGGTCCTTGACATGCCACAGCGTCCAGTGCTCGATGCCTGCAGGAGTGTCATAGGGAAACATATTGGGTTCCAGGAACGCAGTTCTACCCTTCAGAGTC
GTAGCAAAAATGTGTTCCTCAGCAGACCCAAAATTCTCGGCGATCTCGTCAAGGTGGTCCCACTTGCGCTCCTTGCACTCGTCCGTCCTGCTCCAGTACT
CAATGTAGAGTGTGCGGCGGCTGCGTCGCGGTGACTCGCTGCTACATTCAACATCAGCAGCGGAATCATATCCAGGAGCACAGCCAATATCAGCATAGCC
ATCACGAGATACGGAGGACTGGGGGTGCTCGTATAAGCCCTCCTCATCCTCCTCAATGTCAGTAGGTAGATAATCACTGTCCGCTTCAGCGGGCGTGAGC
TGCTTCTCCTCCGTCTTGGCCTTCTTGGTCACTTGATGCTGTTCCTCCTCAGTCTCTTGGTCAGCTTTGCGCTTGAGCGACTGGGAGCTGCTCACAGGAT
GCGCAAGAGCCTCATTAATATCAACGGAACCTGATGCCGGGCGCAGGGCACGCATACCGTCCTGAGCCTCAAGCTCATCACCTGATTCTGTGTTGGTGTT
GTCGATCTAATAAAACCCAAAAAGACACAAAATTAGACACGACCATCACTCTCAAAAAACCATTAAACCCATCAAAGGGGACGCACCTTGTCGCTGTCTG
GCATCGCCTTGTCCGTCGAGCTACGGCTGAAATCGACGTCCGAGATGGACGATGGAGAGTTACAAAACGCTCGTGGCGAGTCCACTCGCTTCTCTGGATG
GGACAAAGCCTCCACGGTGACTACTGCTGGGCATGGCATGTTCTCTGGAAAGGGGGTAGCTTTTAGCTTGCTAAGTTAGCACAGACACCTGCCTGTGGTC
GATCTGCTGTGTCTGTGGACCTGTTCCTGTTCTTGTTTGTCCGCGCGGAGATGATCACGTGTCGTGTCCTGCGCTTCGTCTTCCGTTTTCAATAATGAGG
TTGAGAAAAAAACTGTGGACGCGTGCGGGCAGGCGCATCGTTGGATTTGTACGGTCGGATTCACTTGATTAAAATATTGTGAAGAGATGTCGCCCCTCCG
TAACCGCCCTATCGTTACATTTTGAAGTAACGATAATTGTTCCAGATAGTGGGTACAATTTGTGCTTCATTGGTGCAGACACTCGCGGCCATACAAAGCT
CGTTTACAGTAGCTCTTCATCAAGCATGGGCAAGCGTGCACCCGTGTCCGAGGCGGAGAAGCTTCTGGTCGAGGAAGTGTTCCAGACCAAACCGCAGAAG
AAGAGAAACAAGCGCAAGAACCAGGGCAAAGGCGAACAAGACAAGACCTCGCTTAAACTCAAAGCTGCCTGGGTAGACGATGACGATGACGATGTCGAGG
TGAACTTGGAGGAACAGCCACAGCTTCGTAAGCTCCGCAAGACC