Description :
From Genome Similarity Track
Location :
Scaffold_159:81933- 83782
Transcript NameFunction/comments
g7865.t1XP_008897190.1 hypothetical protein PPTG_05399 [Phytophthora parasitica INRA-310

Sequence
1849 bases(100 bases per row)
ACACAACGAGGCCACCCAAAGTAAAGACACACATCTGGAACAGATCCGTGTACATCACTGCTCGAAGACCACCGGCAATGCTGTACATGGCACTGAGGGT
AATGCAGACACCGGCACCGAGATACAGGTTCCAGCCCAACGTGGCCTGGAAAACGATAGCACCACCATAGATACTGGCACTCATTTTCGTCAACACGTAC
ATGATGATCGTGATGAGCGACAAGTAGTGACGGCACGGAGCACCAAAGCGGTACTCGAGATATTCCGGCGTCGTATACACACCGCAGCGGCGGTAAATGG
GGGAGAAGATCCAGCCCAAGCACAGGATCAAAATGGCAGCGTACCACTCGTACATGGCGACAGCAATGCCGCGGCGAGCACCATCACCGGCCATACCAAT
GAAGTGCTCGGCGCCAATGTTACTGGCGAACAACGCACCACCGACGAAGTACCATTGCATGCCGCGGTCGGCCAGGAAAAAGTTGGACACCTCGTTCATT
TGGTGCTCTGGCCCGTCACGAGCAATGAGAGAGGCCGACGGACGCTGAGATGAGATTGCTGAGCCACGTTCGTCTCCTGCGGGGAGCTTCTTGCCCGGGG
TGGGCTCCGAAGCCAGGTAGCCGTCGCCGGGTGACTCGAGCACTTGGTCGTTGTTGCGTTTGGATCGTTTAATACAGGGAAAATACTTGGCCAAGTGACT
CTCGCCTGCTTGGATGGAGGCGATGACGGCCACGACCATCGTGAAGAACAGCACCGTCACAATGATGACGACGTCCCAAGCGTTAACTTTGGCGCCCCCG
GAAGTGTCGGGCACCGTCTGCGTGTACAGCTCGACCATGGCAAGGACTTGAACTCGACGAAGGTAGACTTGACTTGATACAGGGACCAAGAACGGAGGAG
AGTCGCTCGCTCTCCAGGCGGTGAATTGGATAATGAACTGAACTCGGCGACGGTGGCGACAACAACGGTGGTGTCCATGGATGGCACCACCTGTTGATAA
TAGAGAGGTTCAACTCTACATTGGCCAAAGTCTCACCTAACCAGCCCGCGTTGCAAGACAGGGCCAAACACAACTTGTGTCACAAGGAGGTTGCGTGTCA
AACAACGATGCGGGCGATACTGTAGCTAACCTCGAGCATCGTCGACTTGGTTTTCGCCCAGCCATTTTGACGTCACCAAGCAACATCATTCATGGAACAA
TATGTCCAAGGTAAGCTCGCACGCTGTGCCTTCTGGCGCATGTTGTGAGCTACGCTTACAGCAAGGCTGCATGGATGGAAGGCGCCATGCGTTGGCTGGC
ACATCTTCTCTAGGAAACGCGCGCAAAGACAATCCCGTTCACGACGGAGGCGAGCATCGTCGGATGTCTGCCATGTTAACAGTCCCACAATGGAAACCAG
GACTTATTAGTACTTGTAGGCAAGCTCAACAGCATTTCTGGAGGTAGTTTTACCGCAGCATCTTCAAATTAATCTGGCTTAATTAAAAAAAAAACATGGA
CATCTCCATGTTCAAATCGAAAGCGAATTTTCGAGAAGGCCCCACCCCACGCCTTGGCAGCACTGCAAACCAGCTTGCGATTGCGATACGATACATGTAC
GATACCCGCGCGGGGAATGCCAGCGGCTTTTGTTACGAGTTATGATTGAGTTATAAAAGCCAGCTTCAAAGTGAGCGACGGCGTTGTCCTGCTCGCGAAC
GCGGGCTCAATGTGAATGCTTTCTTGTATACTTCTAGAAATTCAAAAACCGTGACAGATTTCGCGGCGCTGTGATGTCCTAGTCGGCGTGGGTGACGTTC
GAAGACAGCAAATGCACTTTTACACGTGCAGAGATTTACAGACTGGAGA