Description :
From Genome Similarity Track
Location :
scaffold_104:8193- 9869
Transcript NameFunction/comments
Pl_109667protein kinase, putative

Sequence
1676 bases(100 bases per row)
TTCTTAACTTTCTTCACCATTGAAGCGTGTCTGGCAGATACTTGTCTGCAAGCTGCAAGTAGTACGGTAGTTCATCATCGACACAGACGTTATGCACAAC
ATTCTCTGGCACACAAGACACCTTGTCAAGCGAACTAATCCATTCCTTCGTGTCCATGTCTTGAGGCGCGCACAAGTCGTCGTAATTATCCTGTTCGTAC
CACGTCTTGAACGACCAGAAACGGACAGCATCCAGTGCTTCTGCAGGCAGTGCAGTCTTGTTAAGTGACAGCACGCGGTGCAAGTACTCGTCCGGAGTCC
AAGGCAGCATAATGTTCTCCAACCCACAGTGTTTAGCGGTGCTGCCACTACTCTTTTCAGCATCACAATGGTCAGAGTTCAAGCTATTCAGGTCAGAAAA
CTCGATCGAGCTGGGAATACGCTCGCCGACAACCCAGGTCGAGTTTTTGGCCATCCACTCCTGTGCTGAAATACTACGCAACACAGCATTGTTGTCGTCT
GTCCAGCATAAAAACACCATCCCTAAAGCGCGCAGGAAAACTGCCAGCTGGAGCCAGTCGGGGTGCCCGTCATCCTTCACTGCAGTAGCCGTAGCCAGCA
TGTACTTGATCACCCAACTTTTTTGCCGCTCCGATTCTCCTGTAAGTTCCATTACACATTTGCATGCGTCTGAAATCGACATCCTTGCATGTTGCAAACC
TCCATATTTCGCAATTTGGTTCTTCACGAACGTAAGTGTCTGATATTTCCGCATGATCTTGACAAAAAGCGGATGCGGGTCTGCCTTGTTGCAGACTAAT
GACATGATCTTACCACCATCCCAAGGCACAGGACGATCTGACACCTCGACTCGTTTCTCTAATGGGTCAATGCACAGATAACTCCCATGGAAACTACGAA
GTGCCACACCTCCAGCAAGTGTTGAAGGACTTTCTCCACGATGTGGCACCACTTGGAACGTCTCCCAAGTGGAATTTAACGGTCGATCAGCTAAGATCGT
ACCATCTTCTTCTACACATAGGAATTTGCCATGAACGCTACGAAGGAAAACTTCACCTGTTGCACCAAGTAAAGTTTGCCACATGCATCCATTGGTTTTG
GAGCTCACTTGAATATCTCCATCTTCTCCTGCGACAACGCACGTGCCGTCTGGGGTTTGCAGTGTCATCATACAGAACCAAGTGCTTTCTTTGGGTTGGA
CTGGAAAGAAAGTGTTTTTCTGGAACACTGATACCATCGGCACTTTACGGAGGCATTCGTTGCCGTTGTAGAGGAAAAGGACTTTTGCCTCAGGCATTTC
GGCAAAACCCCAACCGCGATAGAGTCCCACCAATTTGCCATGGCGTTTAGAGTCTTCTTCGGCCTCTAAATAAAGTGCTTTAACTTGTTTCTCCTCTAAC
GTGGCTAATGTTGCCAGATAGAGTACACGAGCCAAGCCTAAGCCTCGGAACTCCGTATTCACCACCACAGACTTGACATGAGCCGTGTTGTCCTTCTCCA
AAGTGAAAATAAGTTTGCCAATAGCGCCACGTTGAGTTGCTATGACGAGGATAGAGTAGTTAGATGGTAGTAAACTATTTGCAGGGATAGGTGGTGTTAA
CCACCAGTTACGTACAGGCGAAGAGCACCCAGCGCAGCTCTTTGGTGCGGCGGTCGTCCGTGAACTGAAGGCGGAA