Description :
From Genome Similarity Track
Location :
contig_75:81918- 83111
Transcript NameFunction/comments
g11783.t1hypothetical protein

Sequence
1193 bases(100 bases per row)
GCCTCAGGTCCCTTATCCAAAAGGCTAGGTAGTCCTCCTCCGCCCGAGGAAGAATGCAGCCGACGCCAGATCGTGGTTCTCTGCAGAGGTGCCCGTTGCC
TTGGGCAACTTGTTTGGCGATGTCATCACGGTCTTCGAACCACTTGTGCAGTTGCCGCTTCTTCCGCTTTCGGGCTTCCGCTTGGAGAGAGGGATAGAAG
CGTGTTACTGCTGCTGCCATGCCGTTCTGCTCGACGAAGCTATTAATAATATACTTGCGCTGGTAGCTGATAGCAGTGCGAAGGCACTGGCTTGGCGAAG
CCTCGAAGCCTTTCACGCGTGGGCGGCTTCCTCGGGGCATTCTTGCAGACTGAGTAATGGCGAAGTGCAGAGCTGATGAATGGCTAGCTCGCTGCGTAAC
CTATCGACTGGTGGTAATTTATCTCCGGGGTGCCTTTTGATATGTCATGATAGATGATCAAAATGGAGTAATCTGATAGGTTGATATTTTTCAACCGTCG
CCTGCAAGGGGTGCCTTTTGATAAGAGTTTTGCGGTATTGGTGCGACTCGACCCTTAGCCGGGATCAAATTCTCCGCGACTTCGTCCAGGTGTTCTCTAG
GTGTGATTCCTGCATCTAGGATGGCAGGTAGTCCGTCTTCATCACGTTGCACTCTGCGGATCTCCAGATTCCAGTGTGACAGGATTACGCCCCACTTGAC
GTTCTTACCGTCTGCCGACTTGGATGTCAGTAGCCACTTAAGCACAGAGTATCGGGTGTATACTACGATCTTTGGACTGTGTTCCACCAGATTCCTGAAC
ACTTCTAGGACTCGCATGATTGAAATCACTTCCTTCTCGGCGAGCTGGTATCTCAGCTCAGCGTCGTTCAGGACACGCCCCGTGAAGCGAACCGGATGAA
TGACTCCATCGTACTCTTGGCCTAGTACCGCAGACGCTACCCACTGATTAGCATGCGGGATGATCACAAATGGTCGTGTGCGGTCAGGATGCCGCAGTAG
TGGAGTCGATACAATCTTGCGCTTCAGGATCTCAAACGCTTCCTTGGCTCGCGACAAGTCTCGTCCAGCACGTATCTGTTCGTCCGTCAGCTCATATAGG
ACAGCGGCGATCACGGGGAGGTCTTCGATAAACTTATTATAGTAATTCAGACTTCCCATGAAAGACTGCACTCCCTTGAGTGTCTTCGGGAAC