Description :
From Genome Similarity Track
Location :
Scaffold_302:8191- 9846
Transcript NameFunction/comments
Phyke_g8090hypothetical protein PHYSODRAFT_557723
Phyke_g8091conserved hypothetical protein

Sequence
1655 bases(100 bases per row)
cagcattgcgagCCTGTTCCTGTTGGCGTGAGAGGTTGATCTTGTCCGACTCTGCCTTGGTCTCCTTCACCACTCGCTCGTAGTGAGCTTTCACGCCGTC
CACAACTGCAGCTCGCACCTTGGCCAGCTTGGTACCGTACGcatgctgcagctccagattCATCACCCTATCCATacacaacaccaagcagaaTCAGCAC
TCTACCAACAAGTAGTACGTAAGTAGGCTATCGCCTTACCTATTGCTCTGGTGTTCtaccgccacctccagctgtTTGACAGCCTCCTCCCAGGCCTGTA
GATCCTTCGCCTGCTTGCCCGAAGGCTCCTTGACCTGATACCGATTCATATCGATGGCGTTCAGAGGTACATTGGCAGCCACGCGCTTGAACTCCGTCTG
CAGACGCGTTCTACCACCGAAGGAGGGCGAGTAGTCCGGCAGGTAGTCCAGGTACTTGTCCTTCGGAGGCGCAAACGTAGCCATCTCTGCGCGTATCAGC
TGCTGGACGGTCTGCTGGCTCTGTGGCGAGTTGTACTCGGTGTCCACGTATCCCAATGAGTCGATCAGCGCGCGGTTCTCCACGAGCAGCGGGCACGTTG
GGGGCGCCATGGCTTCGACTGGTAGAGTACTAGGTAGAATAGGTAGAACAAGACTCAGAAATATGAGGATATCTGATGAACCAATCAGTGTTCTCTGATT
CGATGTACCCATGTTGGCTATTGCAACGAACGCCCACCAGGAGCTGGGCGTCGATCATCAGGTCGTCGCTCCCAGCGGACGAAGGCGTCCGAACGCAGCG
CCACAACGTCTTCCAAGACTCACTCTACCCATCCATCAAAGTCATTATCATCACTGATGCGGCCCCGAGTCGTGACCGGTCGCCAAAGTGACGTAACTAA
TCTCCCCATCGACTTGTGGGATTTATTGCTGCACTTCTTGACGTGGCGTGAGACCAACGCAATGCTTCAGGTGTGTTCCAATTGGAAACATCTCGCCATG
AAAGCCAAGAATCAGCACCCAGAGTGGCGGTCGACGGTGTTGGGTCCTGTagccactgcagctgatAGTCTGGAGCTACTTGGAGCCAACCATTTCCATT
GGGCCGACACTCGGTTTGCTCCagacttggtgctgctttcTATTGCCAGTCAAAACCCCACGCCTTGGCGTAGTGGCAGCTGTTGGGAGGATGCAATTGA
AGTCATTGAAGAGAAGAAATTGCTTccgaagagctgcagaatcgTGGGGATTTTCACTATgaatgcagtggtggcacagcaagaagaaTTTGAGAGTATT
GCGACGCCACCAGAGTTTGCTACAACTTTATCGATTTCTGTATTGCATCTTCCAGAGACGAAAGTGGAGACGGCTGCGTTCGAGAGGAAAGAGCTtcgac
gacatcatcgtggaggagctcaagtTGAAAACCCGTTTGAGTCGCTGggggaagaggaagaggtgCCATCCTTCCTGATGTTTGGAGTGAATGATCAAAG
TGCCAGTGAACTTGTGCCTCTGGTGGAAGAATGGTACCCCGGAGCTGTTGTGGTGGGGGCAGTGTCACCGCTATTGGATAGATGCGCTCCTATTGCGATA
TACCACAGCATTTTTACTGAGTGGTCAGACCGTCATCAAGAACGACAATGGCAGC