Description :
From Genome Similarity Track
Location :
Scaffold_172:81902- 83951
Transcript NameFunction/comments
g6225.t1hypothetical protein

Sequence
2049 bases(100 bases per row)
CCTACGCCCTCTCGAACAGCTGTCGGTACGCTATGTTCGCCATGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCGA
TCTCGACGTAACCCTTGACATGGTCACATACAGCTGACCGTGAGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAAGTACTGCACCGTTTGTCCCTGCGCC
TTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGC
GCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCGTGGATGACATGGTCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCA
CAACCCCAGGTCGGGAATTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCATGGAGTCG
AGCACCTCCTGCTCGAATAAGTTCCCGTCTTCATCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGCCCAGTCATACGATCCGCTACGGCTT
CGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACCCGCAAAGTACTCGTCCGTTGCGACTTCCGTATTGTTGATATCGGCGTACAT
CTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCACGT
GGAATCTTCATGTAGTCATTCCCAGATCATTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACT
ATCGGAGGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAAACGCACCTTCAGGAAAAGTAGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTC
TCTGTAGCCGAGCAGCTCTTCACCACGGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAA
CGTCACGAAGCGTTCGGTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTTGTCCCAAACTATCAAACTTGCTTTCCTCATCAATTCCGTGAC
CTGGGATCGCTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAAGGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGCAGAGAA
GCAATCCCACTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGACTTCCCTGTACCGCCTGGTC
CATCAACGAAGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGAGTGATCTGATCATAGGTCAAGCGCTGCTCCTCATTTAGGTGGTCCTCCTC
GCTCACAATTTGTTCAAGAACAGATGCGTCATATCCCGTTAGCTCTCGTCGGATGAGGTTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCG
CTCAGCCGAGGGAGATCAAAGTCTTGGACGGAGTACCCACTAACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGCTTTAA
AAGGGTCCAACATCTCTCGGTTCCTGTAGGCATAGTCAAGCAAAAGGTCTTTGAAGAATTGGCCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGAC
CAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGCCG
GCATGTTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAATAGCAGGC
GTAAATAGAAGCGCTCCATATCACGCGGTGAAACATGCACCACCCGACC