Description :
From Genome Similarity Track
Location :
Scaffold_2795:819- 2284
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2795-snap-gene-0.2Phosphatidylserine synthase

Sequence
1465 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCTTTGGCAAAAGCCCATCGACCCTGGTTAACATACTTCGTCCCTTCT
TTTACCCTTTTTAGCTCATTCTAAAACTGTCTCAAACACCTTTATAAGGTCGTCTGCCTGCGGACAAAAAAGTTGGTGATCGCAATAACATTTTGTATTA
TTAACCAAATTAGCTGAATTAGGATCATTAGGATTAGGATTAGGATTTTGAATACAACTTTTGGTACGACATAGACGAGATTCGATCTCGTTGAAAATGA
GGTTTCCTTCTAACGTGAGTGATGACACACTTGACTTGCTTTTTGTATGCGAACACGCAAGACCAATTTTAATTTTAGCACTTTTGCGGGATTTCAGCAG
ACACGATCCGTCCATTTCCCCATCAACACGCAACACGTAACCACCAAGTGATGGCGTCCACGACGAGCGCGGAGGACGCCCCCGCGCACCGCTACCAGCT
GCGCCAGCGGCGCGCGCCCGGCGTCAGCCACCCGCAGCTGCGGCCCGAGTCACCGCCGACCAACAGCTCCGCCAACGCCACCACCGCGCGTGCTAACAAT
AGCGACGCTGCCGATGGGACCGCCGGACCGCCACCGTCAACACCAAAGACGCGCGTGCTGGGCCCCGGACTGAGCCCGCGGCCAGAGAACTTCTCGTCCG
ACAACATGTTCCGCGCCGCGAAGGGCAGCGACCTGGAGAACATGCTGCTCTTCCGCGAGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTACTTCTCCTTCA
CGCACGACTCGCAGGTGCGTAGTATGTGTTTATCTATGTATGTGTATGGTCTTGGCTCGTGTGTATGGGCAGATACTGACTGCTACATGGCGCAGGACGT
GACGGAGAACGTGCGCAATGGACTCTCCACGGGCGTGCTCATTTTCCTCGTCTACTGCTTCCTGCAGACCCGCGACGGACTCATGGTGCGCAACACAATC
ACGCTCGTTTACGAAATGCATCCCCTCTGTTTGCATTGATACTAATAAGCAACTCGCATGCAATACACAGGTGCGTCCGCACCCGGGCCTCTGGCGCGTC
GTGCACGGCTGCTCAGTAGTGTATCTGCTGCTGCTGGCGGCCACGGCGGTGCAGAACCGCACGGGCGCGATCCTTTCAATGCAGTTCCTCTTCCCCGAGG
TCGGCAGTTTGAAGAAATTGCCTGCGGGTACCAAGCTCGAGTGCGACATTAACGCAAACGTACGT