Description :
From Genome Similarity Track
Location :
Scaffold_602:8189- 16913
Transcript NameFunction/comments
Phyag_g6946conserved hypothetical protein
Phyag_g6947hypothetical protein

Sequence
8724 bases(100 bases per row)
TTGCCAACAATGagcaatgctgctgttgccaaTCTCTGTTCGCATCCTGATAGTCAACACGTAACGGAATTGTGGGGTGCAGCCAATACAGCAGTCCGAC
AAAATGAATCGAGTGACTGGTGCACGAGGCTCACACCCTTCACCGCACCAGCTTCCAGTGCCGTGGTCTTCAACGAGACACTTGAAAATAATACTGCTGA
TTGGAAGCAGTTCTTATCAACACGTCGATCGCCACGGCTTTGCCGAAGCCGTGCTAGTTAAACCGTGATAAAGTTCGCTGTGCGCGGCGGTACCCAAATC
TTGCTACGCGTCAACTAAGTGAGAGGCTCTAGAGGTGACCACCCGACACTCGGTCCCCATGCGatagcagcaacttgatcatATCATTTTCCATTTTACC
CCGTTCCAAGCATCCGCTGATGACTTCGTGCACGATAACGAAGATCGCGGTGCTGATCGCTGTCTTCGCTGCGACGCTCAATGGGAATTCATTGGCGGCG
ACTTACACGTTTGGCAAGGAGCCAACTATGCCAATGCCAATGccgctggcggtggtggttccTACTAGTTCTTCGGACGCTATCAAGCTCCCGTTCAACT
CGTCAAGCAATGATACCGACTTTGGCACGGCTCGATCGACCATCGTTTCGGGTGCTGACGACACGTCCGAGCGAGATCTCACCGACGACTCtgaagacag
cagcgatgacgactACGACGGTGATTCTGGGGCTGTGGCCGTGGCTGCTACTGCGGCGTTGAATGCTGCATTCAAACTCGGCAGTGTGCTAAACGCGACT
AGCACGGTGGAGCAGACCTACACCAACTGGGTGGGTACCGCGCTCAACACTGCGTCTTCCACCGCTTGTTGGCGGAAAGCTCGCATCGCGAAGACGTGTC
CACTGGGATACAACAGCAAGCTCGGGGTGTGCTGGACGCAGTGTCCGTATTCGTATCCTCTTGAATGCGGACTCGAGTGCCTCCGGCAGAATGATGACTG
TACACTTGCAATCGTGTCTAAGGTTGCAGTTGTGGTACAGACAGCAATCTCCCTGTCGGCATGGAGTGTGTATGGTGACATGACCAAGTGGGCGAAAGGC
ATTCAACACGCGATCAAGTGTACCAAGTATATGATCAGTCtctccaagtcgctggtCAAGTTTATACGCTACCACAAGATTTACAATCCAGAAACACCGC
AAGACCAACTGCTCTTCATCCTGTTCCAGATTGACAATGTCATTATTGACATCCCGGTAACGATTTCCTACTGCATGGGGAAAAAGGCGTCTGATGAAGT
CAAACTTGCTGACAGTATACTCACGACCGCAGAGTACGCTTTGAGAGAACTCATATTTCACGGCGACTCCATTGTTTCAAGCTGGTCGGCGTTCACGAAT
TTCATGAAAAAGCTTGCGCTGGGGGCTTCGATTTCGTCGTTGAGGCAGACCGACATCGTCTCATTGAAGTCTGCACTCAAGTCCAATACAACCTGTGGCT
ACGATATGAAACGTCTGCTGGATCGAACGTGGATGactgtggccgagctgcgGCGACAAAACCCTTACATCTCCGAGGACGACATTCGAGTGATCATGAG
TCAGTCGAACCTCGTCTTGAACGACATTCCAATCGCAACAAATAATTGCATGATCGAGTTAATGGAGCAAGGGGATGAGAATTCAGCATACGCCACACGT
GACCTCCTACGCAAGACTTTTGGGGCCATTGTGAACGACTTGGTCAGCTGGGGAACAAGCAACAACGGCACGCTTCTCACTGCAGGGGAATACGCTGTCA
AAATCGCAGATCGAGCTATTGGCTTTTGGTCCATTTGGGATCCGTTCTACGTTTCTTCGGTCGTTTCCGAGTACTTCCAGCCCATTTGTGGCCCCACAGA
GCTTATTGGAgagatcgacgacggcaacgtGAAAAAGTCTCTAGGACTGTCAATCGTCAACAAGGCgttcaacaacagcgacggcaTGTGGACGAAAGTT
GGAGACGGCACTGTCACCATCGCGTTCGAGAGTGTCGACACTGAAGACGTGACGGTGAACATCAAGTCAGGAGGGCATAAGATTGACGAAGTGGATGTTC
CAGCAGGGAAATCTGTGACTTGGAAGATGAACACAACCGCACTAGGAGGGAAGACCTTGTATTTGGATCGATGGCGCCCAGGCTTTTTAGGACTTCCTGG
TACAGGAGGAGGCTCTCTGCTTTTGTGGATTCCTCGGACGACCCACGGTGGTAGTCTGCAACTTACCGCGGTGTTAAATCCGAGTTGAGGGCACTCGAGG
AGAACGGATAGAACTTATAAGCCTGAAGTAATAATGAGAAATAAGTACAGAACGAATTCGAATGCTCGATTCTACCTGTATTACATTGACTTTTAGTCTG
AACACGCTAAAAGTCAAGCCAAACACGAAAACCTAGCACGTAAACACGCCTTTCATGAAGCACCGTGTTCAACATCGTCTCACTTTTCACTGCTCGACTT
CCGTTCTCTCTCTTATTGACACGAACAATGCGGTTCATAGTTCGACCCAAGGAATATTCCAGCAGTGCAATTCGGGTCACTGTGGCTCTTGTACCACTCA
AATTTGATTTCGATGACGCAACACTTTCGCCACTCCAAGGCAGCATTAAAACTGCACGTAATCAATGGAAATCCACCTAGCCGCCTTTCggctccatctt
cgtcggcAATCCCAGTGTACTTCACGTATATGCTGCTACATTGTTGGACCAGGGCGGCAGTGTGGCCCCCTCAACATGCCGTGAACCTGCTGACTCAGCT
GtctgcgacgactgcgaaTGGCTTCAATTTCTCTCTTACGTTATCATGAGCCTAGATTCAAAGCCTTGGCATGCCGACATGCTGGTGATCGAAGGTTGTT
TGCCCCGGAGCGACCGAGTCTTGAGATGGCACAAAACTTGAAACAATCAGCGTACAGTCAGCATTCATGGGCATAATTAACTGCAACTTGACCGATAGCC
TGGGGGCTCTCTGTTGCTGAGAGCAAGCTGGGACCCCACGCGTATCTTCGTTTGCATCTCGACAGTCACAACGTCACAAGACGTTGCGTCTCTCGCAGAT
CAGAGATTCCCACGACAAGGCTCGAGCCCAGTGAATGGCGGAGGTGCCTCTCAAATGCAGTCTAGTGATATTTTGAGTCGAACAGATGGAAATCGCAGGA
ACGCCTTGCAGCGTGTTCAACAACGAAGCCTCTACAAACTGCCTGCTAAACGTCCATTTcgacgatctgctgctgcgactgaaGATTTGCCCCAAAGCTA
GGGTTTTCCCTTCCGTGCATGCCATCACGTATCCGACCAACACGAAATGCCCGCGTCCACGTCCAGTGCGCAAGCGAATTGACAATCACTTTTCGTTTTG
CGTGTTCGGGACCTTTTCTCTTGAGAGTCCGCGTATGATTCTCCGGGCCTTGGTGATTTTTGCTGTTTTCGTTGCAATAAATGGAGACACGCCTTCGGCT
TCTGTGGTGACGATATACAGGTTTAGTAATGGTCGTGCAgaatcaccaccaccacgcgctACGATGACCGcaacatcgtcttcctccaaTTCATCcggca
gtgacgacgactcTCTTGATTCTTTGGACAGTGACGATAGTAACTCGATCGACAGCGATGATAGTGGCTCGATGGACAGTGACGATAGCGGCTCAGACGA
TTCCTCTGAAAGTGACGATGACAGCTTGGAAGTGAGTGGCGGAAAGGTGGATTCGATCGTGTTTTCATGGTCTATGAGCGCGGCAGCGAAACTTGGCGGG
GTGCtcaacaccaccagcacgatTGAGCCCACTTACGTCAATTGGGTAGGTACGGCACTCGATACTTCTAAAACTACAGCGTGTTACCGCGAAGCTCACG
TCGCGAAGACATGTCCGTTGgggtacagcagcaaatgggGAACATGTTGGGCGCAGTGCCCGTATGCGTTTCCTGTCGAGTGTGGAATGGAGTGCATCCG
ACAGAATGACGACTGTGCGCTGGAAGTTGTAACTAAAGTGTCGGCTTTGGCGCAAACGACGCTGTCCTTCATCACGTACGATGTATTTGGCAAGATGGAA
AAGTTGGCGAGGGCTGTTCGAGTGGCTATCAAGTGTGCTAAATACACGATGGGGTtgatcaaggcgctggcgaAGTACGTTCGCAATATTAAGGTAACTG
ACCCACAGACCCCTCAAGACAAAATTCTGGCAATGCTTTATCAGACGGACAACGTCATCACCGATATCCCCATTGCAGTCGCGTATTGCATCGGAAACTC
TGCCTCGGACGAATTCAAGTTTGTCGACAGTGTGATTATGACTGCAGAGTACGTTTTAAAGGAAGTTGTAGCCAATGGTGCCGCTATCCTTTCCAGCTGG
ACCAAGTTCACAGGCTTCATGAAGAATATCACGCTGGGCAATTCGTTTGACTCTCTCAACTCAACTGAAATCACGTCGTTATCGTCTGCCCTCAAGTCCA
ACTCGACTTGTGGCTACGATTTGAAGCGTCTGCTGGATCGTACTTGGATGACGGTGGCAGAATTCCGTAAACAGAACCCGAAAATGTCTAAGGACGACAT
CCGTGTGGTTATGAGTCAGTCGAATCTCGTACTCAACGATATCCCCACGGCGACAAATAATTGTATGGCTGAACTGATGGCAGAATCGGACGAGAAAACT
GCTTTTAAAACTCGTGACACGCTTCGGAAGACCTTCGGCAGGATCATGGATGATCTTATCAGCTCAGGAACGAGTAAAAATGGCACAACACTCAGTGCTG
AAGAGTACGCGTTCACAGTTGCGGACAAGGCATTTAGTTTCTGGGCTATCTGGGATCCGTGGTCTGCCACGGGAGCGATTTCCGAGTACTTTCAACCGAT
TTGCGGGCCCACAGAGTTTATCGGCGAAATCGATGACGGCACCGTAAAGAAGGCACTCGGGATGAAAACTGTTCAACGCGCGTTCAACCACAGTGATGGG
CTTTGGACGAAGGCAGGCGACGGCAGTGTCGACATCACATTTAAAAGTGTTGATACGAAGGACGTGACCGTGAATATTAAGTCTGGTGGCGACAAGATAG
ACGAAGTTGACGTCCCAGCGGGTAAAACGGTGACCTGGAGGTCAAATGTGACGGTATTGGGAGGAAAAACGCTATATCTCGATCGGTGGCGTCCTGGTTT
CCTGGGTCTTCCTGGAACAGGAGGGGGGTCTTTGCTATTGTGGGTCCCTCGATCGAGCCATGGTGGGAGTTTGCAGCTCACTGCAATGCTGAATGTGAGT
TAATTGTTAGAGAAGTTATCGTCGTTTAAGTTGACGTTGACGTCGGTGTACTTGTAGTGAGAGTAATTCAAGTAACAAAGGCATAAAATGCTTGAAGTAT
TCCATCGCCTCGGATTTTTGCAAACGAAGCAATCAATGATCAAAATTAAAATCGATCGGCACGTTAGGATGTAGGACAAACGcacaagaaaaaaaaacgc
AAAGCTTCGCAGTGCGACGCTGGCTTCTGAGCAAGCAGGTGTAAATTACTAGTAATGAAGATTACGTGCATTTCGGGTAGGGAACTTTACAACTCATAGG
TCAAAACCTTGAACTCCCCAAATTTCGTGCTTCCCGATATTGTTGCTTGAAACATCAAGTTGGTGATCAGCATCCACCGGGCCCCCCAAACACAACAGGG
ACACGTAATATTCATTGCGTGACGGCTTTTATCAACGCTCCATTTCAGCCGAACTTACCTATGTGCATTCTAGTGCTCTTCGAAGAATTATATGTGCAAT
GTGTACACTcagccagcaacttgatggTTAGAACGTTCAAAAGGGACAGCCACGTGTTACACTACTTCAGCTACACTTTCTTCTCAGTCGACGTTGGTAC
CCGATAAGGTTCTGACCACAACTAAGTATGCCGTACATTTCGAAGTATCCTACTACAAAATTTGAAATGTTTCAAAAAGCGCATATTGTAGAGCTCTCAT
GACTTCTTCGTGGTACTGACGCATTTGATAATATTCGCCATCATTTCTCATGCCTTTAGCCGCTTCGTTTTTTGACAAACAACCTGATAATCTCATTAAT
AAGTTTTGTGGCCATGAACGCGCAAAGAAAACATTTTTTaatcctccagcatctcAGTAGGTAAGAGAATACGGTGTCCGTGAACAGCTAGACTACCTTT
TCTCGTGCTAAAGTATCTCCAACCGTACAGGGAATGTAAAGTTACTTGTGTCTCGCCAATAGTTAACACAAACAACGAAAAAAAGATGTTCCAATAGGTC
TCGTAGACGAACGATCAATTCTTCGTTGTGCAGCACTTTGTTGTGCAGAAGAACCAGCGGTAAGAACTCTGAAACCAGCACTCTCGCGAAAATCGATAAC
ACGCGGTGGAGCCCTCCTTGTTTCGTTTGTTTTAACCCGTGAGAAGCTCGACGCAAGTTGAGTTTGCGAGTCTGCAAGGAGCTGTTTGCCGTATCTCGGC
GACGTCACCGCGCCTACCCGTCGGTGTGCTGGGTAAAGAGATTTGCCACGAGAAAATAAACAGTGGCGTTGATCTACTGACAACGTTGcgtacatgtaca
gctcGGTAATGAGCTTGGTCGTAAATGAAACTTTTAGAGATCCGCACCAGGTATTCGACTCGCAGTGACCTTCACCACATTACTGTAAAACGCTAATGAC
CCACGGCCTTGCTAATGGAGATGCTCCCGTGGCAGTAATACTGACTCAGTATGCAACACTGGCAGTGTCACTGCGGCTTGGTCGTGCTGCATCGCTCGAC
TGTTCGTGCGTCGCAGCAAAAGAGCTGGCTATCGAACAGCGGAAAGGTCAATGCAAATCGTCAACTTGGAGTCACAactttgcagcagtcgaACCACTGG
CAATCCTCGCGCTGCAAGGCGCGATTGGCGACTGTGAGCTAAATCTACGCACCGCGGTACGCGTCTCACCACTCGATGAGAACGGCCCTTTTGAATCCCT
CGCTTTGCTAGAGCTCGGAGATATTTCGAGCAAGCAGGGTCGCTAGGCTGGTGACTGGATGAGAGAGCCCCCGTGGCTTACATGACGCGCGCGGCGTGGC
CATGCTTCTCGTTGGCAGATGGCTGTGCGGAAGCTCATGTGCTTGACGTCGACAAGCACAGCCGAGGTGATCCCAATCTAACCGGGATGATTGGAAGAAT
CCGCCGAGGCCTTGTTGAAGACATCAGCACGAATCGGAGGGTGTCCACCGGAATTTTTGGTTTACAACACGGTATGCTCTCATCTGGTGAAATCGCGACG
GCCGTCACCCCGTTCTTACCTACCGACAAGCACAAGATCGTTGTTGTACCAAGCAAGCCCTTCCAACCAGCTCGCAACAAAGACCCTCGGTTAAGAGACC
GGGGTTGCACCACTTACCACTTCATTCTTCGTTTTGCCGCACTTGAGGCTTCACAGGCTTCCGCGCTGAGGCGGGGCATCTCCAATATTGACCATGAACA
GGGTGGCATTGctgcttgccgtcgtcgcaGTGATTTTCATTGAGATTTCGTCGGCGAAGATCATTACCATTAGTGTGTGGCCAAGAACTATGACTTCTCT
TGCTACTGTCGCACCTGGTGTTGATAACCTCACGGATATTGGTGAATTGACAACGACCGAGTCTACTTTCAAGTCTGCAAGTGGATCCGAAGATAGTGAA
GAGTCCGACTCATCGGAAGACAGTGTTCTTCAAACCTCGATCTTGAGCGAATCCGGTGCCGGCTCCAATCACGATAGTGATGATTCTGTTGATTCTCTTG
ATAGCGACGATAGTGACCAggactcttcttcttcctcctcggctgcagcttcggggTCAATGAATGGGGCACTGCAGATTGGCAGTGTACTCAACGCTAC
CAGCACGATCCAAGCTACGTACGTCAACTGGGTTGGATCAGCACTTGATACTTCAATCGCCTCGGCATGCTACCGAGAAGCTCACATCGCCAAGTCCTGT
CCTTTGGGATTCGACAGTAAGCATGGAATGTGTTGGGCGCAGTGTCCGTATTCGTACCCCATCGAGTGCGGGCTCGAGTGTATTCGgcagaacgacgact
gcGCACTGGAAGTCGCCACTAAAGTTGGTACATTTGTCCAGACCTCACTATCCTTTGCCACGATGGGCGTGTTTGGTAAATTCTACAAGTTGGCGAAGGG
CATACAGAGGGCTGTCAAGTGTTTCAAGAGCATTCTAGGTTTGACCAAGTCTTTGGTGAAGTATATCCGCTACGTCAAAGTGTCCAACCCTGAGACGTCG
GAGGACAAACTCCTCGCGATATTGTACCAAACAGACAATGTTGTTATCGACATCCCAGTGGCAGTCATGTACTGCAAGGGGATAAAGGTGCACGACAACA
TCAAGCTCGCGGACAGAATTCTTACCACCACAGAACTCGCTTTGAGGGAAGTCATCAAAAACGACGAAGCTATTGTCTCCAGTTGGGACAAATTCACAAG
ATTCATGAAGAATATCACGCTGGGCGATACAGTCGAGTCGCTGAACAAGTCCGATATCACGTCGTTGAAATCTGCGATGGAGTCGAACTCTACCTGCAGC
TACGACATGAAGCGTCTGTTGGACCGCACGTGGCTGACGGTGGCTGAATATCGCAAGCAGAATCCAGGGATGTCTGAGAACGAAATTCGAGCCGCGATGA
GTCGATCAAACCTGGTGCTAAAAG