Description :
From Genome Similarity Track
Location :
contig_183:8189- 12946
Transcript NameFunction/comments
g14625.t1XP_009525441.1 hypothetical protein PHYSODRAFT_360288 [Phytophthora sojae
g14626.t1XP_009526653.1 hypothetical protein PHYSODRAFT_502885 [Phytophthora sojae

Sequence
4757 bases(100 bases per row)
GCTCAGCACTGCGATTATCTTGCTCTGGACGGTGCCTACAGGTATCGTTGTGTCTTTTGCCAAGGTTTCATCGCTGGAGCAGAATTGGGCGTGGCTTGTC
CAGGCCATTCGAGATCACCCGTGGGTGGAATCGGTGCTGGAGCAGGTGTCACCGTTGATGCTGTCCGTCATGACGGCTTTGGCTCCGATCATCTTCGGCA
TCCTGTCCAAGCGCGAGGGTCATGCATTTGATTCGCAGGTGAACGCGTCGCTGTTGAACAAGCTGGTGATCTACCAGATCTACGTGACGTTCTTGCTGCC
TATTTTCGGTGGTACCGTCATCGATGCAGTCATGGGCTCGGGTGACACGGATCTGACGGATGTGAGCGCCGTCCTTACCATTATCAGTGATGCAGTGGCG
GTGCAGTCGGCCTTCTTTATCACTTATCTGCTAGTCAGAACGGGACTCAATTTGACGTTGATCTTGCTGCGCGTTACGCCAATCGTCAAGGCTGCTATCT
ACCCAGTGTTCGTGCCCAAGCTGACACCTCGTGAGCGCGCATCGGCGTGGTTTGGCCTTAACTCACTGGCTCACCCTGGCGATTTTAGCGCTTCGGACCC
AGTCTCCGAGTATTTCCTGGTGCTGATGCTTGTACTGGTGTTCTGCGGTATCGCCCCTATCCTCAGCTACTTCGCGCTCCTATACCTGGTGCTATCGGAC
TTTGTGTATCGTTGGGCGGTCATGCTCCATCAACGCAGACGTCTGGCACGTACTCCCGTCTCTATACCGCTATATCGTTGATGCCCTCCTGTTCGCACAG
ATCATCTTGGCGTCCGTGTTGGCCACCAGTATCGAAGCTTGGTGCCGCCGGTGCAGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCT
GGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGC
AGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGT
GGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCG
TGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCAC
ACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCA
TTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGAC
GACAGAGTGCGTTTTGGTATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTG
CCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCG
TTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCT
GATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCG
CATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGG
TCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGTATCGCATCTACTTTA
TATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGT
ACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCG
TACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCC
AAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGT
GAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGC
TGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCG
CAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGG
TGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGC
GTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAGGCCAGCCTTTTACAACTAGGAGAGAGAAG
AATACGGTGGATCTTCGTACAAGCATTGTCAGATAAGGTGATGAAAGCGTTACCACATTGTGGCAACGTTAGTGTGGTTGAGTTCACTGGCGATAAAGGT
TATAGCGATCAACTGGATGTTTAGGCAAGATGATTAACTTCTCATGCAACTTTGCAGCTCGTTGCCCAGCACCGGTTTAATGTAGTTCAGAATTTCAACC
TAAGTTAAGGTGTTGTTATCACGACAAGCTAAACGTGAAGGTGCATAACACATTTTGAAAGTGCTTGAAATTGCTGAATGGTGCTCAATTATTTTGTATT
ACTCCCTCCGTTTCACAATAGTTGACTTCAAGTGGGCAAGTCAGTGTTTCATATTAGTTGACAGTTTCTGTGATTGGTGGAAAGCCAATTGTGTTTGGCC
AGTCACTGCGTACAGCTGCTGAGGTTTCTGTGTGGGTGCTGTTTTAATGCGGGTAGTCGGCAGGTTTAGCATAAAATTACTGCGGGTAGGCAGCGGTTTT
TACTGAACCTACCGTCTTACCCCGCATAGAGCGCATGAGCACTCAAATAAAATAAAATAACCACTGAGCACTGTATTCGTTTATACTGCCTGGCCATGGT
CGAGTGAACAAACTCACTACCTTTGAAGACGAAGTCCTTGAGCACAACTTCGGCATGTATGTATAAGTACAGATGTTGGGTCTCAGAGTTCAATGTGCTG
ACGGCTCAGCTGGTAAGATCATGGATTGGCGATCAGCTGGTCCATGGATCGATTCCAGTCGTGTCAATTGAGGGTCCAATATGCGAAGAGGGTTGTCACG
AGTCAAAATTCGTTAATGCTCCGCACAAAATGGCAAGTTCAGTTTGGTATTTCCATTGGTCCCGTGCAATCAGAAACTAACATTGTTTGTTCTTCTTTTC
GTTGCAGCTAGACTACAGCAGATACCCGTCCACCTTGACAGCGAAAAAACCACCCGACCGACCCAAGCAGACGTCCTTGGCTGCGTTTTCCGCTGCATAC
GTGAAACTGGATTCAAGGCGGCCCTCTGCGTCTACTGTTTTTAGGGTGATGTTCCAGCCGTGCATCGTTGCAGCCTCGAAAATCTCCAGCTCACCTGGGT
CGGCATCGCCATCCCTCACAGCCGCAAGGTAGTTCTCATCTAGAAGACCATCCAAGTCACTCAGTGTAGTCATGTAGCGTGTCAAACTCGACGCGTACTC
GTGTGGCGACACCGCCAGTCCGTACGCCAGACAGCAGAAGAGACTCGAGCGCTCCTTCTCGGGGACGTACCAGTCTGGTGCTGCGATGCGTAAAGACTCG
AGGTCTGCGCCTTCGTCGACAAGGTGCTGGTAAGCCGCGTGCCACTCACTCATGTCTAGGTCAGGCTTGAGAATCGCCTTCAGCGGGGCGTACAGCTCAT
CCATCTTGAACGTCGCCTTGGCAACCAATCCGCACAGCGTAAAAGCCTTCTTGACACTGTCCCCACTTTTCGTGACAACCCAGTCAAGGGTCCACTGCGC
CATCTTGGCGTAGTGTGACATCTTGGGATTCCCCGCCTTGCTCTGCAGACTGGGATCCCGTAGTGCAGTGTCGATGTAGTCGCCGTACTTGGAGCGGTAG
AACTCCTGATAGCTGCGATTAATAGCCACATCCAGTGGCTGCAGCAGATTCGTGAGGTTGAGCGGGACGAGCAGCACAAAAATTTTGTAGCGCTCCAGTC
TCTTTGAGTCGGCCAGCTTCACGTGGCATCCGTACGAGTCAATCACATAGAGTACGG