Description :
From Genome Similarity Track
Location :
Scaffold_391:8189- 11631
Sequence
3442 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTGCAGACCAGGGACACGTGAACGACTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTATGTTAAGGAGTGCTGTGTGCCCCGTCACACAAAGCTACGGCATCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCGACA
CCTGAGTCTGTATAGACTGACCCTCTGTGGAGAATGGAGCAGTTCGCTCACTTACCCCCGAACCAGCAGGATGCGCTTAAAAAGCTTATGTCCTTGCTGG
GCCCGGAGGGCGTGACGCAACTTGCGCAGCAAGGCCCCGACGCGGTGAATGCGCGTCTCGAGGCGTTTTAAAGCTACGAGAATGCTCTCCTAGAGCACCT
CCAGCAGAGGATGGCGACGGCCGCGGCGCCCCAAGCGGCTGCTTCGTCATTCGACGCGGGAACAAGACCCAAGCCGCTCATGTTGAACGTGAAGACCTTC
GAAGGCAAGGAGGGTGAAAGCCTGATGCTTTGGACCCGTGAGGCTGAGATGGCTATGAGCTCAGCTCTACTTCGGACGGAGTCACAGCGCGTGGCACTAG
CTATCTCGAAGCTCGGTGGGCGAGCGGGAGAGTGGGCACTAACGTCCGGGACGTCGGTCGAGGTGGCCTTCCCGACGTGGGACCAGCTGAAAACAGCAAT
TGTCCCGAGTGTTTTGCTAACGAGGCGTATCGCGTGCGCTCACGCTTCCTGGCGACCAGGCAGAGCAAGAAGGAGTTGACGGACTATGTCCAAGAGTTGA
GAACTCTCTTTGCTGGTATGTCTGCGGACCCTCTGCCGGAGGCAGTCACCGTTACGGTGTTCATGGAGGGTCACCGCACTGGCGTTGCCAGGACGGAGGT
GTTCCGAACCCACCCGAGCTCTTTTGAAGAGGCTGTGAGCGTCGCATTGAATGCGGAGCACAACTTTAATTCGTCGAGACTTGGGTGGAATGCGTCTTAC
GCTAGCGCGTCAAGTGGTCCGGATCCCATGGACCTCAGCTATGCTGAAGACGAAGAAGCCGAGGTTCGTGCTGCTGAGCATCGTCGCGGTATCCGCAGAT
GCTTCATCTGTGGTGACACCCGTCACCTTCGTGCAGGGTGTCCGCTGCGCCATCAGCGCCATGCTTCGTCAAGCCGCTCCTCCAGGGCTCTGGTTTGTCT
CGGGGAAACGAGAAGTCCCAGTAGGCGCGAGGCGGCCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGAGGTCGACAGGACTTAGCCCC
GAAGAGAGCCGTACTCTTTAACACGGAACGTGTATGGAAGCCGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCACCAAGCCATGGACTATTTTA
ATCGATTCGGGAGCGTCGGGTAACTACGCCCGGCGTTCTACGATGGACGGAAGTCAGCTTTATGCTGAGGCGCTGGTAGCACGCGGAAGTGAAATCGTCA
CTGTTCGTCTCGCGACGGGCACTCATGTCACGGTGCCTAATGTCCCTGTGGACCTGGGCGTGAAGTTTTTGGATTTTGATAGCGTGGAACGCTGTCTGGT
CTTAGACCTCAATTCGAGATATGATCTCATCCTTGGTATGGCGTGGCTGGAACGCCACGAGCCTTGGATCGATTGGAGGTCGAAGACCCTTGGTGCTACG
CACTTCTCTCCTGGCGGAGCATTGGCGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTGGTGCGAGCACTGGACCGAGTCGGTCAATGTGCT
GGACATCGGAGTTTCCGAGTTAGTGGATACTGAGTGTGTCGAGAACGAGCGTTCCGAGCGTGGCTCGCGGACGGCAGGTGGAGCGGCACGAATTCCGCTG
AGCGGGAGTGCGTCTGAGGGCGACGCCCTGCTGCGTGCCAGCGACGGTGCGGTCGGTATGATGCCGAAGAACAAGGGGCTTTGCCCGGATGAAGATCGTG
GAGTGGCACGTAATCCACTGAGTGGAGGCTGCGGATCGTGCAGCTTTTTGCTGAGTGTCGGTAAAGACACTGGAGCTCCCCCGGAGCTGAACGAGGTGGT
GACACCTGGCGTCAAGACGCACGCGAAATCACGGAGCTCTTCAGGGCGGACGGTGTCCATGAAGAGGAGGCAGCGCCGCAAAGCGCTGGCTGCGAGACGC
AAGGCGTCTGCGATCTCACGAGTCGAGAAGGGCGTGTCAAGCGGCGAGGCTCCACGCGAGAGCGAGCAGCTCTATACACTCGTGAATGGAGCGACGGGCG
ACGTCGACGAGGTATCAACGTCGACGACTTGCCCTCACTGTCTGCTCTCTTGGAGCTGGACGAGCTGTCCTTGGCCGGGTTCGGCGAAGCCTTGAAGGCT
GGAGACTTGGCCGAGGTAGTGGTCATACGACCCGAAGAAGAGTTGAACTCGTCCTCGCTGCTGGATGAAGCTGTCCTGGAAGACACCGAGAAGGCGCTGA
ATGCGCGGAGCGGATTGGCGATCCTGAAGGACCCGTCGGATCCCTTGTATCAAGTGGTAAAGGATTACCAGGATGTCGTCTCGAAGGAGCCGCCCTCGGG
GCTACCTCCGAATCGAGGTGTTCGACACGAAATTGATCTCGTTTCGGGAACGAAGTACTGCATGACGAGGCAGTGGCCCTTGCCGAAAGAGCAGTGTGAC
GTCATTGACGCGTTCTTCCGTGCGAAGCACGAGGCGGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCCGACGTTCTGTGTCAGAAAGCCGAATG
GCAAGTGGCATATCGTGCATGCTTTCAACAAGCTGAATGCCGGTACCATCCTGGCGCAGACGCCGATTCCTCGGAAGGATGTTCTTCAGAGCAACATGAC
AGGATGTACGATGTACAGTGCGCTCGACTTGGTCGATGGATATTACCAATTGCTCATGAGGACGAGCGACATTCCTCTCACCGCGGTGAGTACTCCGAGC
GGCATGCTCTGAGAGTGGTTGCTGATGCCCCAAGGGCTTTCGAACGCGCTGGCGACATTTAATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCGT
ACGCGCAAACGTACCTCGATGACATTTTTGTCCACAGTCGTGCGGAGCACGGAAAGACTGATATGCAGAACCATGTCGAGCACCTGCGTGCTGTGCTCGA
ATGCATGCGTCAAAACAAGTTGTACGCCAACATTGACAAATGCATCTTCGGAGCGGAAGAGATCCCCGTCTTAGGGCGCTTCATCGGGAAGCGTGGCCTG
AGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGTTCCCAAGAACCAAAAGGATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTGCACAAG
TACAGCGAGAACTACGCTGAGATGGCTCGGCCACTCTCCAAT