Description :
From Genome Similarity Track
Location :
Scaffold_22:8189- 9709
Transcript NameFunction/comments
Sapdi_VS20SDRG_07533hypothetical protein

Sequence
1520 bases(100 bases per row)
GACAAGCGGCCCCGTGACAGCCGTCGATTGGAACATCGATGGCGCCTCGGCTTCCACCGCCACGTCCGTCCCCGCGCTCTTGAGTTGGCACGCAAAGTTG
GCGTAGTTTTTGATGGCACCAATGTCGACGCTAGTGCACTCGAAAACGCGGTCGGGGAGGTTCTTTCGGTTCTTGAGGTTGGGTAGTTTGGCCTGCGGGT
CGGCGATAAACCAAAATCGAATGTCCACGTGCGCGGTGAGGCGCTCGAGGTCGATGAGCGGCCCCGAGATGCTCATGGCACCGGTCGAAATGCCGTAGAC
GGCATCCAGCAAATGCGCATCGCCGCGTACGTTCTTTTCGTATGCTTCCGCCGTATAAAAGTCGGCGACGTTGATGTCAACGACAGCTTCTGACGCACTG
TCTTCGTTCGACGGCGCGAGCAAGGCCGCGTCCGCAGCGCCAAGTTTGATGTCGATCGAGAGAAGAACGTTGACGTCCTCCTTCTGGTCGTCCTCGTTCA
GGAATTTACCAAAGGCGACTGTGCTGCTGTAGTCGTGCGTCGCGAGGAGGCCAAGGCCTTGATTGAGCACGTTGCCTTCGATCGCATCTACCAGTTGCAG
CGACTTGTAGAGATGCAGCCACTTGCGCGGGTCGCTTGTGATGTGCTGCATGCCTGCCGCAGCCTGCAGAGCGAAGACGAGGAGTGCGACGGCTCGGACC
ATGCTGGCAAATGCTGTTGTGGCACAAGCTCTGCTGCAAGCCGCTGATCCACGCGCGTATATCTAGAAGAAGTGACGCATGTTCGCGCGCGAAAAGTCGG
AGGATCTAGAGCAATAGAAAATTTCTACTATAAATGCACGCACTGCCCTCCAGGACACAGCAAGCGAAAGTGCTCTCCGAGATACGCTAGCTGACTTTGG
GTGAATCGCGGAAACGAGCGTCCAGTATCAACGACTAATAGGACGTGGCTTGAGCATACCATGCAGGACGTTGACATGACTTCAGTTGCTAAATTGGCGG
TCGCCATGGTGTGCTGCGTGGGCTGTCTTACTGCCACCGTACTCTTTGTCGTTGCGCTCGACCTGCGATTCCGCGCGGTGCACCTATTTTCTTTTCTCAG
CGCCGCGAACGAAGTCGCATTCAACGGACCCCACCCCGACACCGCAGCGACAATAGCCTGATACAAGGACACTCCTCAAGCGACTACGATGTGACGACTG
CAAATAATCGAGTGTACTCTAGTTGCGCATACTCCTTGCTTGCGCTATTCCAAGGGAAGTAAAAATCTTTGGCCTTCATGAACCACATCTGCAGGGACGA
CCTCTATGCGACCACCTCGCCTGAAATGCGCGTGATGGTGTTGCATTATACACTGTGTTAGTCGCCTTTCTGTGGCACACACTGCGCGTAGTACGTGTTG
AAGGTAAGACACATCCAGCCCTTGGATTGACAGCACGTCGCTTGCTTCCAGTACCGCCCGCCACATTGCCCCCAGTCGGCGCTGCAAGCCTCTGGGTTCA
TGGTGGGTGGCATGGTGCCC