Description :
From Genome Similarity Track
Location :
contig_75:81888- 83051
Transcript NameFunction/comments
g10002.t1hypothetical protein

Sequence
1163 bases(100 bases per row)
TTCCGCTTTCGGGCTTCCGCTTGGAGAGAGGGATAGAAGCGTGTTACTGCTGCTGCCATGCCGTTCTGCTCGACGAAGCTATTAATAATATACTTGCGCT
GGTAGCTGATAGCAGTGCGAAGGCACTGGCTTGGCGAAGCCTCGAAGCCTTTCACGCGTGGGCGGCTTCCTCGGGCATTCTTGCAGACTGAGTAATGGCG
AAGTGCAGAGCTGATGAATGGCTAGCTCGCTGCGTAACCTATCGACTGGTGGTAATTATCTCCGGGGTGCCTTTTGATATGTCATGATAGATGATCAAAA
TGGAGTAATCTGATAGGTTGATATTTTTTCAACCGTCGCCTGCAAGGGGTGCCTTTTGATAAGAGTTTTGCGGTATTGGTGCGATCGACCCTTAGCCGGG
ATCAAATTCTCCGCGACTTCGTCCAGGTGTTCTCTAGGTGTGATTCCTGCATCTAGGATGGCAGGTAGTCCGTCTTCATCACGTTGCACTCTGCGGATCT
CCAGATTCCAGTGTGACAGGATTACGCCCCACTTGACGTTCTTACCGTCTGCCGACTTGGATGTCAGTAGCCACTTAAGCACAGAGTATCGGGTGTATAC
TACGATCTTTGGACTGTGTTCCACCAGATTCCTGAACACTTCTAGGACTCGCATGATTGAAATCACTTCCTTCTCGGCGAGCTGGTATCTCAGCTCAGCG
TCGTTCAGGACACGCCCCGTGAAGCGAACCGGATGAATGACTCCATCGTACTCTTGGCCTAGTACCGCAGACGCTACCCACTGATTAGCATGCGGGATGA
TCACAAATGGTCGTGTGCGGTCAGGATGCCGCAGTAGTGGAGTCGATACAATCTTGCGCTTCAGGATCTCAAACGCTTCCTTGGCTCGCGACAAGTCTCG
TCCAGCACGTATCTGTTCGTCCGTCAGCTCATATAGGACAGCGGCGATCACGGGGAGGTCTTCGATAAACTTATTATAGTAATTCAGACTTCCCATGAAA
GACTGCACTCCCTTGAGTGTCTTCGGGAACGGCAAATCCTGGACTCCCTTCGCAATCTTTGGCTTCGCCCGGATACCTTCAGCACTAATTCATGCGAGAG
TACGGAATGGACAACTTGCCAATCGCTCTTGGGTAGACTTTACAGAGATATTCCAATAGCGTA