Description :
From Genome Similarity Track
Location :
contig_183:8188- 12935
Transcript NameFunction/comments
g11953.t1hypothetical protein PHYSODRAFT_360288
g11954.t1hypothetical protein PHYSODRAFT_502885

Sequence
4747 bases(100 bases per row)
GCACTGCGATTATCTTGCTCTGGACGGTGCCTACAGGTATCGTTGTGTCTTTTGCCAAGGTTTCATCGCTGGAGCAGAATTGGGCGTGGCTTGTCCAGGC
CATTCGAGATCACCCGTGGGTGGAATCGGTGCTGGAGCAGGTGTCACCGTTGATGCTGTCCGTCATGACGGCTTTGGCTCCGATCATCTTCGGCATCCTG
TCCAAGCGCGAGGGTCATGCATTTGATTCGCAGGTGAACGCGTCGCTGTTGAACAAGCTGGTGATCTACCAGATCTACGTGACGTTCTTGCTGCCTATTT
TCGGTGGTACCGTCATCGATGCAGTCATGGGCTCGGGTGACACGGATCTGACGGATGTGAGCGCCGTCCTTACCATTATCAGTGATGCAGTGGCGGTGCA
GTCGGCCTTCTTTATCACTTATCTGCTAGTCAGAACGGGACTCAATTTGACGTTGATCTTGCTGCGCGTTACGCCAATCGTCAAGGCTGCTATCTACCCA
GTGTTCGTGCCCAAGCTGACACCTCGTGAGCGCGCATCGGCGTGGTTTGGCCTTAACTCACTGGCTCACCCTGGCGATTTTAGCGCTTCGGACCCAGTCT
CCGAGTATTTCCTGGTGCTGATGCTTGTACTGGTGTTCTGCGGTATCGCCCCTATCCTCAGCTACTTCGCGCTCCTATACCTGGTGCTATCGGACTTTGT
GTATCGTTGGGCGGTCATGCTCCATCAACGCAGACGTCTGGCACGTACTCCCGTCTCTATACCGCTATATCGTTGATGCCCTCCTGTTCGCACAGATCAT
CTTGGCGTCCGTGTTGGCCACCAGTATCGAAGCTTGGTGCCGCCGGTGCAGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCG
GTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCAC
GCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCA
GCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCG
GTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCAT
GGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCT
TTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAG
AGTGCGTTTTGGTATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCC
GGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTG
GCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCA
GCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCT
ACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAA
ATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGTATCGCATCTACTTTATATAC
ACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGC
TTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAA
TGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAAC
CGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCA
AGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCC
GGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCA
CGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCC
AGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCC
GGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAGGCCAGCCTTTTACAACTAGGAGAGAGAAGAATAC
GGTGGATCTTCGTACAAGCATTGTCAGATAAGGTGATGAAAGCGTTACCACATTGTGGCAACGTTAGTGTGGTTGAGTTCACTGGCGATAAAGGTTATAG
CGATCAACTGGATGTTTAGGCAAGATGATTAACTTCTCATGCAACTTTGCAGCTCGTTGCCCAGCACCGGTTTAATGTAGTTCAGAATTTCAACCTAAGT
TAAGGTGTTGTTATCACGACAAGCTAAACGTGAAGGTGCATAACACATTTTGAAAGTGCTTGAAATTGCTGAATGGTGCTCAATTATTTTGTATTACTCC
CTCCGTTTCACAATAGTTGACTTCAAGTGGGCAAGTCAGTGTTTCATATTAGTTGACAGTTTCTGTGATTGGTGGAAAGCCAATTGTGTTTGGCCAGTCA
CTGCGTACAGCTGCTGAGGTTTCTGTGTGGGTGCTGTTTTAATGCGGGTAGTCGGCAGGTTTAGCATAAAATTACTGCGGGTAGGCAGCGGTTTTTACTG
AACCTACCGTCTTACCCCGCATAGAGCGCATGAGCACTCAAATAAAATAAAATAACCACTGAGCACTGTATTCGTTTATACTGCCTGGCCATGGTCGAGT
GAACAAACTCACTACCTTTGAAGACGAAGTCCTTGAGCACAACTTCGGCATGTATGTATAAGTACAGATGTTGGGTCTCAGAGTTCAATGTGCTGACGGC
TCAGCTGGTAAGATCATGGATTGGCGATCAGCTGGTCCATGGATCGATTCCAGTCGTGTCAATTGAGGGTCCAATATGCGAAGAGGGTTGTCACGAGTCA
AAATTCGTTAATGCTCCGCACAAAATGGCAAGTTCAGTTTGGTATTTCCATTGGTCCCGTGCAATCAGAAACTAACATTGTTTGTTCTTCTTTTCGTTGC
AGCTAGACTACAGCAGATACCCGTCCACCTTGACAGCGAAAAAACCACCCGACCGACCCAAGCAGACGTCCTTGGCTGCGTTTTCCGCTGCATACGTGAA
ACTGGATTCAAGGCGGCCCTCTGCGTCTACTGTTTTTAGGGTGATGTTCCAGCCGTGCATCGTTGCAGCCTCGAAAATCTCCAGCTCACCTGGGTCGGCA
TCGCCATCCCTCACAGCCGCAAGGTAGTTCTCATCTAGAAGACCATCCAAGTCACTCAGTGTAGTCATGTAGCGTGTCAAACTCGACGCGTACTCGTGTG
GCGACACCGCCAGTCCGTACGCCAGACAGCAGAAGAGACTCGAGCGCTCCTTCTCGGGGACGTACCAGTCTGGTGCTGCGATGCGTAAAGACTCGAGGTC
TGCGCCTTCGTCGACAAGGTGCTGGTAAGCCGCGTGCCACTCACTCATGTCTAGGTCAGGCTTGAGAATCGCCTTCAGCGGGGCGTACAGCTCATCCATC
TTGAACGTCGCCTTGGCAACCAATCCGCACAGCGTAAAAGCCTTCTTGACACTGTCCCCACTTTTCGTGACAACCCAGTCAAGGGTCCACTGCGCCATCT
TGGCGTAGTGTGACATCTTGGGATTCCCCGCCTTGCTCTGCAGACTGGGATCCCGTAGTGCAGTGTCGATGTAGTCGCCGTACTTGGAGCGGTAGAACTC
CTGATAGCTGCGATTAATAGCCACATCCAGTGGCTGCAGCAGATTCGTGAGGTTGAGCGGGACGAGCAGCACAAAAATTTTGTAGCGCTCCAGTCTCTTT
GAGTCGGCCAGCTTCACGTGGCATCCGTACGAGTCAATCACATAGAG