Description :
From Genome Similarity Track
Location :
Scaffold_692:8186- 9617
Sequence
1431 bases(100 bases per row)
GGCCTTGCGAGCCGCAGCTGAAAATGAGAGCAAAATGAAATTTGAACGCTGCATTTAAGTACGATGTGCTGACCTCATAGAGTGTGTACACCACATAATG
CGACTTTAGCCTATCGACGCCGCCTTCGCTGCGCTCGGCAGCCAGTAGAACGCCCGCATTAGCGTGAGTTTTATTAGCCCTACCCTCGGACGGACTTACG
GACAGACAACACACTCCACTAGAGAGGTAAGACTAGCCGTTCGCCGCCGCTACGCGGCGGAGTGGCATGGTTTGTTGTAGATGAGGTGGCCGCAAATTTA
AATGCTTCTTGATGTCGCGTACTTTGTGCGTCGTTCACCCCAGTAGGTCTTGGCTTCGTGTTCTTAGCCACTTACCATTCCGTAGTCTCTCCCAGACCCG
TATAATATCGTGGTTTAGTACGCTTCCGTTACCCCGTACTACCGGTTGGATGTCATGTTCTTCAGTGGCCGGCGCTCTTATGTGATCTTCCTGGCTTCGT
GGTTTCCTGCTCACCCGTGGCACACTCTGCTTAGTGGTTACACTCTCTCTCTTTTGGGTTCATTCTCTTTAGTACGGTCTCTTTCGTGGCTGCTACCTAT
TCTCTGTTCTCAAACGTTTACGTGGGTTGCACCGGTTTCGTGGTACGTAGTTTTTCGTGGTCGTTGGCCTCCCGTTGCCAATACGCTTTCCGAAGGGTGC
TATTCCGTGGTTTAATGCCTCCACGCGCTCCTGTTGTTTCGTCGCCCTTGTATCGTACTCTCCTGGTGAGGCTTCATTATCGCGCTATCGTGCAATCGCA
GTGTGGCTCTGTTGTCTATGCAATCGTGCTCGCATAGTATATATGTTTTGCTCATGCTATCATGTTCTACGCTAATACCATGCTCCACGTTGTGGAATCG
TGATCTCCCGGATCCTTCTCCCGTTATTTCTTGGCTGGTCCGCCGTCCTACTATTGGATATTAATGCGCATAAGCGTTGGCCTCCCATTGCCAGTACTCT
AGACTACGGGTGCTATTCCGTGGATTGGTGCCTCCACGCAGTCGTGTTGTTCCGTCGCCCGTTTGTCGTGCTCTCCTCGTGAGGTTCCATCGACCGCATA
ATTCTGCTATCGAGCAATTGCGGTGTGGTAATGCTCTCTATGGTATTGTAGTGCATCGGCGTTGCCAGTGTTTTATCGTGTCCTATAATGACATTGTACT
CTGCGGTGTGCCATCGTCGTCACCCCATCGTGTTCCAACCGCTGCTCTTGTTTGGTCGGTTGACTGTGCTCCGTGTTCTACTGTGGTGTTATGGGAGAAT
TCCTGTCCGTGCACGCTTACAGTTACGTGTTCTACCGTGGCTTCTAACGTCCAGGCTCTACCCTAACTTCTTACGTCCGTGCTCTTCCGTAGCTGTGCTT
TTCAGCATGCTGGGGTGTCTATATATTTTAT