Description :
From Genome Similarity Track
Location :
Scaffold_419:818587- 820722
Transcript NameFunction/comments
Aphin_H310_01125Methionine synthase

Sequence
2135 bases(100 bases per row)
GTGCTTTGTGTCTGTTTACGCCAACGCTGGTTTGCCGAATGCGATGGGCGGGTACGACGACGACCCGTTGCTTATGGCCAAGTATTGTGGTGAATTCTGT
GAAGAAGGACTGCTGAATATGATCGGCGGGTGCTGCGGCACGACACCGCTCCACATCAAGGCTATTGCAGACGAAGCCAAGAAGTCAAAGCCGCGTCCGC
AATACATCCCGAAGGAGCCGTTCATGTGGCTCTCTGGGTTGGAGGACTTGATCGTGACAAAGGAACGATTTGCGTTTCTCAACGTTGGCGAGCGATGCAA
CATCAGTGGGTCGATTCGCTTTAAGAAGCTCATTTTGAAGGGCGACTACGGCACTGCGATGGAAATCGCGCGCGCCCAGGTCGAAGAAGGCGCAATGGTC
GTCGACGTGAACGTGGACGACGGGATGCTGGACGGCGTGTCGGCCATGGAGCGCTTCCTCAAGATTGCAGTGACCGAGCCCGACGTGTCCAAGGTACCGT
TCATGATCGATTCGTCCAAGTTTCACGTCGTCGAAGCCGGGCTCAAGTGCGTGCAAGGCAAGTGCATTGTCAACTCGATATCACTCAAAGTTGGGGAAGA
CGAGTTCATTCGGCACGCAAAGATCGTCAAGAGCCACGGCGCCGCTGTTGTCGTCATGGCGTTCGACGAGTTCGGTCAAGCGGCGACAGAGGAGGAGAAA
GTTCGCATTTGCAAGCGGTCGTACGACATTCTGGTCGGCCCTCGCGTCGGGTTTCCCCCGGAGGACATTGTGTTTGACCCGAACATTTTGACAATTGCCA
CCGGGATGGAAGAGCACAACAACTACGGAGTGGACTTTATCAACGCGTGCCGAGTCATCAAGGAGCAAAACCCGTACTGCAAGATCTCGGGCGGAGTGTC
CAACTTGTCGTTTGGGTTCCGTGGCGTCAACGTCATTCGTGAAGCGATCCACAGTGTGTTCTTGTACCATGCCGTCCAAGCAGGCATGGACATGGGGATC
GTGAACGCCGGGATGCTCCAGGTGTACGACGACATTCCAAAGGACCTGCTCCAGATTGTTGAAGACGTCGTGCTCAATCGCTACCCTGAAGCGTCCGAGC
TGCTCTTGGAGCGTTCGTTGCTCGAGCGCGAAAAGGCCGAAGCCGCCAAGAAGGGCGGCACCGGAGCAGCCGTGGCCCAGCAGGAATGGCGCACCAAGCC
TGTAAGTGAGCGCTTGACCCATGCGCTGGTCAAGGGCATTTCCGACTACATTGACGCGGACGTGGAAGAGATGCGGTTGTTGTGCGAACGGCCGCTGCAC
GTCATCGAAGGGCCGCTCATGGACGGCATGAACGTAGTCGGGGACTTGTTTGGGTCGGGCAAGATGTTTTTGCCCCAAGTGATCAAAAGTGCACGCGTGA
TGAAAAAAGCCGTCGCGTATCTGCTGCCGTTCATGGAAGCGGAGAAGCTGGCCCAGCAAGCGAAGGACCGCGCTGACGGCATCGTAAGCGCCGACATGGA
CGAAAACAGCATGTACGCGGGCAAGGTCCTCCTGGCGACTGTCAAGGGCGACGTCCACGATATTGGGAAGAACATTGTCGGCGTCGTGTTGGGGTGCAAC
AATTACAAGATCATTGACGCTGGAGTGATGGTGCCATGCGAGGAAATCCTGCGCCTGGCCAAAGAACACAACGTCGACATCATCGGTCTCTCGGGGCTCA
TCACGCCATCGTTGGACGAAATGGTGTTTGTCGCAAAGGAAATGGCAAAGGCCGGCATGACCCAGCCGCTCATGATTGGCGGTGCCACCACGTCCAAGAT
GCACGCGGCTGTCAAGATTGCGCCGCAGTACTCGACCATCGACCATCCCGTCATCCACGTCTTAGATGCGTCCCGATCGGTTGTCGTCGTGGGCAACTTG
CTCAAGGAAGACGAGAAGGCCGATTTTGCAGAGGAAATTCTCGAGGAGTACGAAGAGTTGCGCGAGGACTACTACGCGTCCATCGATGACATCAAGATGA
TCGCGTACGACAAGATCTGCGCCAAATCGTTCGCGATCGACTGGACGGCAAGCCCTCCGTATGGCAAGACAAACCAACTCGGAAACCGTGTCGTGGATGG
CGTGGCGCTGGCGGACATTGTCCCCTTCATCGACT