Description :
From Genome Similarity Track
Location :
contig_118:8183- 10206
Transcript NameFunction/comments
g11301.t1hypothetical protein

Sequence
2023 bases(100 bases per row)
CGGCGAGGCGCCTGTGGGCACGGTTGCTGGCTCCGGTTTGGACTCGAACGACATCAGTCTCGTGAGTGAAACGATCGAGATACCGACCATGATGCTACGC
AAACACCACCACCGTCACCACGAAGACGAAGACGAAGACGAACAGCAGGGTGAGGAGACCGTGGTTGCCAGGATCGTGATCACGGGAAACTCGACAGACC
TGATCAACATGATTGAGGCTGCACCTCTGCACCCACGACGCAATGATGGACTCAAGCTTCACCTGAAGAACGAGGACGCGTACGCTGAGGGCTACGTGCT
GACGTACATCTACGTGTTCGAGAAGAACCTGCTGCGTCGCGTTACCACGGCATTCTCGGGTGACGTGGTACTAAACGACGACGTGGTGACACTCGACGAC
GCAGAGGCGGACGTCAAGTTCGCCTGCGTGGGCGACGCCAACCTGTACCTGGAGTCCAGCACCAACGCCACGTTGGCGTCGTTGGAGGTGGAAGTGACGG
GCAACGGTCTGGCGCAGCTGGAGATTCCCTCCGTGAACCTGGGGGGCGACTTCAACGTGGAAGTTGCTGGCAGCGGCGCCGTGGCCTTGATCACGAGCTC
TCTGACTGCTGACGACGTGAAGACCACGCTCTCTGGATCGGGCAACATTGTGGTGGACACGAGCGACCTGGAGGCTCAGAAGCTCGATGCAGCCGTGTAC
GGCTCTGGTGTTGCTAGCTTTGCCACGGTGGGCTCGGTCGACAAGGAGACGCTGACGCTGTCCGGACCAGGTCAGCTGCTTGCTGGCTCGATCGTGGCGC
GCAAGTCGGATGTGGATGTGTGGGGTGACGGCGACATGCTCGTGCAGGTGACCGACCGACTCACGGTGTCCACGTCGGTGTGGGGCAAGGTGGGCTACGT
GAACGCGCCGCCCACGGATGTCAAGATCAAGGGCTGGTGGTTCTGGCGCGAGGCCAGCTCCATTGTGTACCCCGCCGCGGTGAACAAGGTGCTGATCTAC
GAGCCGGCGACCGTGCCGTCCAAGCACCCGGTGTACTACTCGATCGAGACGGCCGAATCGGCGCTGTCGGATGACCCGGACTACGCGTTCGTGTCGGCCG
AGTCCGCCAACGTGGCGAACCTGATGACCACATCGTTGTCGAGCGTGGAGCAGACTGCTGCTGCCTCAACGGGCTCGCAGGGTCTGTTCTATGCGTTCTT
CGGCGTGGGCGTCGTGGTGGTGAACGTCGTGGCTGCCCGTTCGTGGGCGCAGCGCCGCGTGCGTCGTCACTACACACGTCTCCTCTAAGCATAAGACAGC
GCGGTTGGCAGCGTAGTGTAGCCTGGAAGGACAGAGCTCCACATCGGTTATAGTTTTGAAGAGCAAGAGGTGCGAGGAAGGCAGTGTTCTTTGAACGTAT
CGTTCGTCAGACAGATCGCTTGGATACTCTGGCACGCGGCTGCAGATTCAGTAGCAGCAGTATGAAAGATTTGCGTCAACGACCAAGAAATCAGATCTAT
GTAACCCAGCGCGCAATCACCGGGTTAAATTCAGACCTAGTTAAATCCGCTCATTTTTGGCTTCTTAAATAGGTGTAGCAGTTTAACACGCAGATTCTAT
TGGAGTTTATCGTAAAAAACATCTCGACGGGTTGGGTGAAATGCGTGGGTACGCAAACTTGGATCCGCAGATCAAAAGGAGAGGGATCTTGGCCACAGTT
CGATTCGCAAAGTAAAGAAAAGAAGTAACAAGCGAAAATGGCTCTCACCGACGTTATCCTCGCTCCGTACGCCGCCGCCAAAGACGTCGCGCAGAGCATG
AACCCGGTGATGCTGGCCGCACTCGTCGCCATCGTGGTGGTCGTCAATGTGGTGGCCGCCAAGTCGTGGCAGGCGCGACGCAGCCGCCTCGAGTACAGTC
CGCTGCTGTAGACGCCCCATCTATCCTTTGACGCTCAAACCACGGCCGGAATCCAGAGGCAGAAGACGCGAGCGGCGGCGTCGCGATCTTAAAATGTGGC
ACCGAGTTTGACCCTCGTTGCTT