Description :
From Genome Similarity Track
Location :
Scaffold_73:818- 23974
Transcript NameFunction/comments
Physo_139332pol protein
Physo_139333hypothetical protein
Physo_139334hypothetical protein
Physo_157971hypothetical protein
Physo_157972hypothetical protein
Physo_139337hypothetical protein
Physo_139338hypothetical protein

Sequence
23156 bases(100 bases per row)
TATTCCCTCGATGGTGGCCTGTTGTTCTACAACACTGGCCCCGAGGATACGCCCCGCGTGGTCGTCCCTCATGATGAGGATCTGAAGTACCGCATCCTCT
ATGAGGCACACGACACGCCGCTGGCCGGTCATCTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGCTGTACAAGTGGAC
GAGCACTTATGTGCGCACGTGCGAGACGTGCCAGCGAGCGAAGTCGTCACCTCATGCTGCAGCGCCGTTGGAGAGTTTGCCTGTCCCTTCGGGCTGTTGG
CAATCCATGAGTATGGACTTTGTGTTTAGCCTGCCGGCGGATGCGGCGGGCAACACTGGAGTAGTGGTTTTCGTGGACCGACTGAGCAAGATGGCTCACA
TTGCGGCTGTGCCGGATACCATCGATGGTAAACGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGTCAATTGTCTCGGA
CCGAGACCCCCGCTTCACGGGCAGCTTCTGGAGCGCGGTCTTTGCGGTGCTTGGCACCAAGCTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGT
CAGACAGAGCGCGTGAATCGCGTCGTCGAGGACGTGCTCCGCAGCATTTGCGCCGAGACGCCGAAGCGCTGGAGCGCCATACTGCCACTCGTTGAGTTCG
CGTTGAACAACGCCGTACACGCCTCGACAGGCTACACGCCGTTCTACGTGAACAGTTTGTCTCATCCCCGCGTCCCGCTGACGCCGCCACGTGGTGGCCT
CGGGCTTGATGGGGGAGGAGAAGCCGATTTAGCTGATCGGCTAGCCGATGTCAGCCCGGATACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGTCGCGT
CTCAGTGTCTTACGACATGTGCGTGACACAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGGGCAGAGGCAATGTTGAAAGTTATG
AGGTCGGGGACCTGGTGTTGCTTAATGCTAAGAACCTACCTACACATGCAGTGTCTGCCGTCTTCAAGACGAAGTTGCGCCCGCGCTTCATCGGACCTTT
CAAGGTTGTGGCCAAGAAGGGCCTTGCGTACACGCTCAATCTTCCGAAGAAGATGCGGACGAACCCCGTCTTCTACGTGGGCTTGCTCAAGCCATACCAG
GACCCGACGCAGGTGCACCGAGGGTGACGAGGTCACAGGCGCGGAGGTCGCGGTCGTCGAGGACGCAGTCGCAGGCGTCGAGGACGCGACCACCCACATG
GGCACCGCAGACACAGGCGGAAGAATCGGCGCCGGAGGTGCTGCGGGCACAGCGAGAGCCGCAGGCCAGGAGTCGCGGCAGTCGGAGCCTGCATGCGGGC
CAGGAGGTCGAGCTGACCCTGAAGCACAGCCTGCTGACGCTGTATCTCCCCGAGCTCCCGGCCACGTTGCTCATCGCGATCGCGATAGTATCGCACCCAG
TCCTCCAGGGCCCCAAGGCGGTCCCAGACCGCTCGAGGCACCTCGATCCATCGCGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCGGACCAGAC
GTGCATCGACGTCGTGGATATGATCCCGAAGGGGACCCGCCTGCTGCCGCACCTCCAAGAGCTCACTTTGAGTCGCGAAGGACCCCACAGCGGCCTCCAC
CGGCCCTGCTCGATGAGCATGGGAATCTACATTACCATGTGGAGCGCCTCCTGGCGAAGCGGCGGTGCCGGGGTCAAAACCAGTATCTGGCGAAATGGGG
AGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCGCCAAGACTGCCCAGACGTCGTGGACGGTTTTGATCAGCTTCATCACCAGCGC
CCTGAGGGCTCAAGGCGGCACGCCGGCCGTCCCGCGCTTCCCGGCAATAAGCTGGGGAGCTGCTGGGTCAGCCACATTGCTCCGAGGCTGACCCTGAGCC
ACAGCGCTCACTCCCTCGCGGGAAGGAGCGGCTGGAGTGCTCGAAGGAGCGAAGCGCGCAGCGCTAAACTGGGTCTGCGGCTGGGTGAGTGCCGAGAGGC
TGCGCTTGGCTCGGACCTTCGCGAAATCGAAGCGGAGCTCGCGTTCAATGCGAACATCCACTTCACTGAAGCTGGCTCGGAGAGCGTCCATGGAGCTGAG
CTTTCGGCTGTGCTCGGCCCAAGACTCGAACTGAGCTTCGTACTCGATTGAGTCTTCCCCCGGGCTAAGTACCACCTGGTACGTCCACATGGCGGGCACG
GACTTCTGCTGGGCTTGCAGCCGCAGCCTCTCGCGATACTCCGCGACAGTCGTAGATTGTGGAGTGAGGAGCCGTTCTCGCAGAGATGTACGCAGTGAGA
GCTCCTCCGCAGTACGGGCCACGGGCCCAATGGTGTGCAGCGCGAGAGACTGCTGGAACGCCTGGCGACTCCGCGACAGTCGTAGATTGTGGAGTGAGGA
GCCGTTCTCGCCGAGATGTACGCAGTGAGAGCTCCTCCGGAGTACGGACCACGGGCCCAATGGTGTGCAGCGCGAGAGACTGCTGGAACGCCTGGCGACT
CCGCGACAGTCGTAGATTGTGGAGTGAGGAGCCGTTCTCGCAGAGATGTACGCAGTGAGAGCTCCTCCGGAGTACGGGCCGCGGGCCCAATGGTGTGCAG
CGCGAGAGACTGCTGGAACGCCTGGCGACAAGCCTCCGCGGGGTCGCGAGGCCGGAAGCCGTAGTCGGCAGTGCTGGGGTTCAGCAGAGGCCGCAGCTCG
GGGCGCTGGGAGCGCATGGGAGCCATCTGCGCCGCAACCTGCTCGGACTGAGCTTCGTCCAAAGGGTTGGAGATGACGGGGCCCAGGGGCACGCCCTCAC
CACGAGATGGCGAATATCGTGGCTCAGTGAGCGCGCGCAGCTCGTAGAGGCCGGAAGAGCGTTCAGGGAACGGGTTCGGAGTTCGCAGCGGTGGCCGCGG
CCCCTCCCTCGACGGCGCACCGCGCTCTGCAGGTGGACGGCTCGGCGAGCGCACAGGAGGCGTGCGCGCGGGGCCCTCTTGATCGCGACGGCTCGGAGAG
CCAACTGGGGCCGGCGAGCCTGCTTCACGGCGTGTCGACGTTGTGGGCGAAGCGTCACCGCGGCTCCGGGAGCGTCGCGTGAGTGGGGACGCATCTCCTC
GGTTCGGAGAACCCTCCATGGACTCGTCCACCTCGCCCTCTTCACCAAAGAGTTCCCTAGGATCCATGATCTGGCGGGTTGATGCTCGAGGAGAGCTGGG
GCTTGTGCGCTGCGAGCTGCGCTTCAGGCGTTGCGCCGCGAAGTACTCGGACACCGAGAGCCTGGAAGGCGTCGAGGGTGTGCGCGCGGGCGCTGGCGTT
CGCGGAGGTGCGGAGGCACACAGTGCAGCAGCACGAGAGGAGCGAGGCTCCGAGGCGGATCTCGCGAGAGGCTGTCTGCGGTCGAAAGACCAAAAGGCTT
TATGACTTGAAGTCATGTGAGGGCGCGTTGCGCCGAGAAGTTCTCAGAGAAGTCCACGCGATGTGGATTGACTCGTTCGAGAAGGAGGCTTGACGGAACA
AGACCCGGTGGTTGACCGTTAAGCGTGAATACCCGTGTCCACGGTTTGGTGAAGGGTGTAACGGGGTTACACGAGAGTTACCCGAAGGGTTACGAAGTGG
GTACACACTGTCTAACCTAAATCAGTAGGAGAATCAGTACATGCCTTCAGAGCCACTGATTATGCATATGACTAGGGTTCACTATGCTAGATAGTGAACC
GGATACATTTACACCGTAGGCGGTTTTGCCGCAATAAAGGGAAATACATTCAGTTTGAGATTCACACAGTTAAGAGTTAAGGGTTGACTCTTGGAGTCCG
TTAGGTGTACGGACTCGTACGTTCTGGTATTAGAACGGGCTATCTTAAGCTGACTCTGTGAGTCTGTTAAGCTTCCTCTGACGCATAGCTACGGCAGCCC
CGCTGCACATTGGCACGCGCTCCTGCTGAAGAAGACTGATAAGCGCGCTCCAATTTGGCTCGGGCGTAGCCTGTTCCTCCTGCTCTTGTAGTTCAACGAG
CCTCGCCTTCTTGAAGCCACCGATGATTGTGGCCGTCGTTAGAGATGTCCATGCACTCTTGATCCAGGCGATGACGTCAGACCTTGAGGGTGCGGTCATT
TTGAATGCCGCCTCGCGACTTGATGAGCGGACTTGTGCTAGGAGAAACTGGACCCATTGGTTGCGCAGGTGTTCCTTGAGCGGGCGGTTCCAAGCCACGT
CCGCCGGCTGGCACACGTACGTGTAGCCTGGGAGGACCTTCATGAGCTCGACATTGAGCATTCTAGCACAGATTAGTACATCTTGGCGCTAATGTCCAGA
GAAGTCGTCCCATAGAAGCAGCACGGGTTCGTGCATATTCTCCCGGCGACCGAAATGATAGCACAGAAACTCGATAGACAACTCGTTGTTCTACCACCCA
GCGAGGTTGCCGTAGATCTGGACACCTACCTGCTGGGTGTGGAGTTCGTCCCAGAGCTGGCGACCAAACCCTTGGCGGAAAATCGTGATCTATCTTGCTC
TCTCAGCAACTTTGGATGGCCGCGTCTTGAAGACCAGGAAGGGTCCGCCTTGTTGCCGTGACTATCCGCCAGCAGCATCGCGGTCACGCGCTCCTTTAAC
TTTCCTGCGCACTTCACCCAGACGGTCTTGGCGCCTCTGTTGTTGACAGTTGCCTTAGGAACGTACTCATAGTTCACACCTTCATACAATAGGTTAGTAC
TTGTCATCATAACAGTCTAGGCTGATGCGTACCCGTCTGGTTCGCGTTGTAAACCTTAGTGATCTTGATCTCATTCATTTTTTCTTGCACTTAGCGGCTG
AAGTCGGCAAGTTTCTCGCTTGCTCTTGCGGGGTAGTCTGTCCCTCGTGCGTTTTCCTGTGAATTAACAGCTTGTGGTGGCGTAGGAAGTGTTTCCTCCA
CGAACACGAAGCCGTAAAAGCTCCACATGGAAGCCCGGTTGCCGCATAACGATCACGAGCCTGTAGCTTCAACATCAGCCCTGTCACAGGAACGCTATCT
GCTCGCAGGTCAGTCACCCACCTCATAAGCTGTTCCTCAGCGACAGTGGGCAGGGTTGCACCTATGCCATGCGCCCCTACCTTGACTGTCATACCATGGA
GGAAACGATTACCCGCTTCAATCCAAGCCTAGAGCGCTCTCAGGTGGGCTCTAAGAAGAGGCTTTGCTACACATGGATGCTTCTGGAGAGCTGATTGGGG
CTAAGTGTGCGACCAGCTTAGGGAGCCACCACCGCCACCCAGCTTGAAGCGCTGCCACTCGTTTGTAGACCTTGGGTTTCGAGCCATTGCCAGTGGTCCT
CTTTCTTCCTGTGCGTGGCATGGCGGTAGGGCAGGCTTTCTAGCTGGGTTTTGCTGATCGAGGTGATGGCTTGGCGCGAAATGCAATTGTGAGGGCGAGT
TGGCGCGAATTCTCTTATAGATGGCTGGTTTGGGGATTCTATGAGCTATAGCATTGAATTAAAGGTAAAAAAATTGGCGTTTTATTTATAACACAACTGA
ATTTTGATTGGGCAGTCGGTGCTGTGAACTATGATATATCTGCGAATTATGAGCTCTGTTACTTAATCGATCGATTTACGAGCAAAATAGGCAAATTTAG
CGATTTCACAATAAGTAAATGAGGGTATGGGCCCTATAAGAAGCGACGTAAAAGTGAGTGAATCAAATGGATACCGTAACTAAACAAATCTGAATCTAGA
ATATCGATGTATGTATGGACCTACAGTATTCAACGTGGTCCAATCAGAATGTGCCATTTTTCCGGTGATTCGTTTAACTGTCTTTTTCGCGTCGCAAAAA
GTGCAGTACAATCGTGTAGAACTCTAATCAACGCATGGCCTTCCTGGAGGACGATGACGCCGTGAGCGCCTTCGAGGCGGCGCTGTCATTCGTGGAGCAC
TACTCCATCGACACTTCCCTGTTCACGGCTTCCCCCTCCATGTCCGGAGCTGCCGGCGCCGCCTTCTCTCCGTTCCTAGCGTCCGGACCAGTCGATGACA
TCGAGCTGCTATCACCAAGTCTCCCGCCGCTTGCGCCTACTTTAGGGGCCGCGTATGCGTCTCCCGGGGCAGGAAGCGACACATCGATGGCATCTCCCTC
CTCGCCCGCGTTCAATCTCTCGAACGAACCGACTGCGAGGCTTGAACTCGGCCTGCCAGCCGCGGGACAAGTGTCGACGAAGAGGAAGACCGTCACCAGA
GGCAGGAAGAAAACGACTGGGCCTAAGAAGCCTGTGACTAGAGGAGACCCCAACAGAGCCAGAAATGAGCGGAAGATCGAGCTGGCGTATCTTAGAGAGA
AGGTGGCGCAGCTAGAACTAGAGCTGAAGGCGATAAAGCTCCACCCGAGGGCGCAGACGCGAGCTATTCGACAAGATGGGGAGAAGAAGAGCACAGAGAC
TGTGGCAGAGAATGAAGCCATGGACTCGACCATGTCAGTGTACGATCCTGTGCAAGTGCCGACGGTGTGGAAGGAAGTGGCGTGTCGCCAACGCAGGAGG
AGGGAGAAGGCAGAGCGTGAAAATGTCCGGCTCAAACTCATCCTGGAGAACCAGATTAAGATGGCGAAAGGGCTGGAGAGTCTGTTACAGAAGAGAGCAA
AGCAACAGGTCGGTGCAGGCACGGTTTGTGTATTGGCTGGTTGGCTATTGATGATGATGGAGTGGTGTCTGCGTTGTTGTTGGCAATTTAGGTTGTGGAG
TGCTCGAGTCTATCACAAACTAAAAAGTCCAAGTATTCGCAGGGACGCACACTGGATTTCCGTGCGGACGTGAACGATTTCAAGGACCTGTTGGCTCATC
TTGACAGGGCGTACCGTGAGGTGGATACTGTCTTCGCTGCTAACGGATTGGCGACAATGGAGACCACGCACCGTGACGCTCGAATGCGCGAGGGCGCCGA
CTGCATGTACCTGGACATTTTTGCGAACAAGGTCATGCCGTTTGGAATGCGTGCAACGGCCCAAGCCGTGTGGGACCACTTTAAGGGGGCGGAGAAGCAT
CGCGGTAACATGTACGAGGGGAAGGTGGCAAAGGTGAGAAGCCGCCACAGATTGATCGATCAGCGTACTAGTATTTAATTGACCTTTCGTTTCTGTGGTT
GCATAAAGCATTTGGAGACCCCAGATACGCCGGACACGATCATCGAAGACTTTGCGAAAGAGTTCTTCGCTGATAGTGCACGCGCAGACTTCCATGCGAA
GCAGGTGTTGCGGCGCTACGTGGAGGAAGATCGCGAAATTGTGATCTGGGTTGCTAGTGTTGTTCCGCTAGAATTTGACGACCAACGTGTTAAAGGTCTT
GGCTTCCGTCATCAGGGATATGCTGTCACGAAGCGAGCAAAGGTATCCAAACCAAACCGGGAGTTCTCGCTTCTTCAGCTGTGTTCCCTCGTGTCACCCG
AGAAAGAAGATCACACCGTGTACGACCCTGCGGCTGTGCGTGCACTAACTGACTTCATGCTGGGCACTGTAGCCGGCAACATCACGGCAAGCCAGGAGCT
GATCGAGAACGTTTTGATGGATCAGGCGGTCAAAATGCACCCATGACGCCTACATTTCCTCCCAATGTTTGTTGCACGTACACTAATACAAAACATGCCG
TTTCATGTATTTTTCCATATCTAATGTTTCCTGTCCAGACGAGTTCGAAACGCAATCTGTGAGCTTGGCCTACGCGTGAGATGCGTTTTGCTGACAGCTC
GGTGGAGCAAATTGTTTTCGATGAGTTCACGATGGGCTCGTTGGTTTTGCGCTGCAAGGACGGTCAGGAAGTTTACAAGTGCCCGCAGACTCGACGGATC
GTATCGAAGTCGGGCTTCATGGTCCAGATAGATGAGCGAACACTGCTGAAGCACAGAAACCTCCTGGTCTGGAGTGGAGTGAGGGGACCGCTTGATCACC
ACTTGGCCTCGAAGGTTGTAGGTCAAGCCGCGCAGCATTTTGTGCTTGATTTCTACTGGGGTTAACCGTGCAACCCAGATTATAATGTCGCGGTCGCCTT
CGACGTAGCGTCGGATCACTTGCTTCACTTGAACGTCAGCTCGAGCACAGTTTGAGAACAGCTCCTTAGTAAAGTCCTCTATGATCGTGTACGGCTGATC
GATATCCCGAAGGGGGAAATGTAACGCAGCACTTGGTTAGAGATTCCATGCACTTACTGGTCGCTCAGGACTAACACACCTTTGCCGATTTCTGGTACAG
GCCACCGTTGCCCTCTCCATTCCTTTCCAGTGGTCCCATGCGACCTCTTGAGTCTCCTGCAGCCCGAACGGCAGCTCCTTGTAGGTGAAAAACTCCATGT
ACTTGCCGTCGAAGTCTTCCCGAATATGCACGTCACCCGGCGAGATTGTCATGTTTGCCAGACCATTGGCCAGAAGCATGGTATCCAGCTCCAAGCGGGC
AGCATCAAGATGTCTGAACAGCCCCCAATATCTCCACGAAAGTCCAGGACTCGATCAATGTAGTGCCTCGTGAAAGCGGGGTCTGTGAAAGCTGAATACT
CTTTCATCTGTAGCAGGAAGAAGTACGCGCAGTGGGGTCAGTAACAAGTGCATGTAGCTCACAAGAAGGTCGCAGCGTACCAAATGAGTCGCTCGCTTCC
GTAGCAAGCTGCGCAGACTGTCCGCCACCTTCTGCTGCTGCTCCACGACCACCTTCAAGCGAATATTCTCGCTTTCAGCCTCCTCCCGTCGGAGTCGTTG
CCGAGCCGCCATCTCCTGCCACACTCTCGGTATCATCACCACTTCATCTCCACCCTCTCCTGTAGCACCTTGTTGGCTTGAATGCTCGGTCGCTCTACTC
TGTAATGCCTTCGACCTTCTGCAGCTGCTCGCGCAAGACCGCGATTTCCTTCTTACGCTCGTTGCGCGACCGGTTCGGGTCGCCGTAGACGCCGGTCCTG
CGCAGCATCTTCCTCTTCTCATTGAACTCTTTCTTCCGCCTCAGCTTCTCTTCCTCTGAGCGTTGTCTTGCCGGTACTTGTACTTGAGTCTGCGTCTGTG
TCGTTTGGCTGGGAGAGGACTCGTGCGCATTATGAAGCGGCAGGAGCGTCTCATCCTGTCCGCATAAAGCTCAAGGTCTCCGACATTCAGGAAGGACAGC
GCAGCTTCGAATGCATTGTCGTCGTCCAGCAGAGCCATCTCAACTGTACGTAAGCTTGTGTTATCAACGGATAAACTGTTCGGTGAACTTCGATCGACAA
AAATTAGGTTTTTAGGGTGCGACCAGATGATAGAGCTTGGTCGACCAGGGCGTTCTCGATGAACTCGCGGTGGGCTCGCAAGTTCTGGCCGATGCTGACG
ATCATAAAGTCTGTGATGGTACGCGCGTCGTCGACCCCGTACGTAGTTTCGATGTCGCGGTCGATGGAGATCATGTAGCAGAGCTGCAGTACCGAGAGCT
CTCGGTCCGGAGTCGATTCTGGAGACCGTTTGGTGACTGCGTAGCCCCGCAAGATGTACGTCAGCCCGCGAAGTCCAGGCAATGATGTCGCGGTCTTCTT
CCACGTAGTGTCGGATGGCTTGCTTGACGCGAATGTCGGCCCGAGAGCTGTTGGAAACGATCTCCTTCTTGAAGTCCGAGATGAGCGTGAACGGCTCGTT
GAGATCCGTCTGACAAGAGCGAGGAACAGGTCACCGCAGTCAATATTAGCAGACCATTCTACCTGCTACAAGCAGGGGATTAGCGTGTACCTTCTCGGCT
TTTGTGTACAGACTGCCATTGCATTGATGCTTCTCAACTCCTTTGAAGTGTCTCCAGGACGCCTCCGCGGTTGAGCGCACGTCAAAAGGCAGCGTTTTGT
AGGCCGACAGCTCAAAGAAGTTGCCATCAACGCCTTCTCGAACGTGCACATCGACCGGCGAGATCCTCGTCCCAGCGAGGCCATTCGCCATGAATACCTC
GTCAAGCCTCCGATACGAAGCCTCGAGGCGCTGAAAGAGTCCGTGAAAGTCGTCCAGGTCGCCACCCAGCCGCAACACGTCTACTACATGGTGCTTCGAG
CGCGCCAAAGTCATCAACAACGAGAATTCATTCGTCTGCAAGTGAAACGCACGCACACACGCGCACATACAAGTGAGTGAAAAAAACTCTCCGATGAGAG
CGTTGAGCATACTCTTCGTACCAGTTGCACCGCTCGCTTCTGCATCAAGCTGCGCAGACTGTCCGCCACCTTGGTCTGGCGCTCCACAGCGAGTCGCAAG
AGCACATTGTCTCGCTCAGTCTCCTCCCGGCGGCGTTTCTGCTGCTCCGCGAGTCCCTTCCACATGCCCCTGATCTGCGTCGACTCCTGACCAACGCCGT
CGCATTCGCTTCGTCCTTCTCTTTCTGCTGCTGCTCTTGGGCCTGCCGAGTCTTCAAAACCTCCAGGTCGATCTGCAGCTTCTCCATTTGCTCCCGGAGG
TAAGCGATCTCGCGTGAGCGTTCGTTACGCGCGCGGTTGGCGTCGCCGTAGACGCCCGCTTGGCCTTCGGCGTGGTGCACACGCCAGAGTCGTTCGAGTT
GTTCGAGTCGTCCGTAAGCGGAGACAATGAGCCTTGACGCGCAGCGGCGCTCGGTACAAAGTCGTCCAGGAACGACAGAGCAGCCTCCAAGGCCGCGTCG
TCATCTACTAGCGCCATGCCACGCACTGCCCCCACAGGAACGTCGGCTGCAGTTTAGGGAAAATGTCAGCTGTCTACCGCTATATTTTGCGCTGTGCTAG
AGATCGGTCGATCAAAGCATTCTCGATCCGCTCCCGGTGCGCCCGGATGTTCTGCTTTGTGGTGGCCACGAGGAAGTTGATGAGCGCCTGCAGGTTGACG
GCGTCGCACTGTACGTCGACGTCTTGGTCGAGAGACACCATGTAGCAAAGCTGCAAGACGGAGACCTCTCGGTCTGGGGTGGACTCGGGTGAGCGCCTGG
TCACCGCGAGCCACGAAGATGGTACAGTCAAACCTGTTTATATGATCCTCTCTATTTGAGCCATGCCGTTTATTTGATGCAGGCTTTGTCGCTACCAAAT
ATTTCACTTAGTTTTTGTATGATCTCTGTTTATATGCATACAAGGTATATGAGTCACATTTTTGGGGACCAAATTAGGTCTCACCTGTTTATTTGATTCA
CACTGCTCACGGCCACACACTCTTCAAAGCACCACTGCTCAACACTCAACGCCTACCGCAAGCCTTCTTCGCTCGCCATGTCTCCTCGCACCTGTCTGAC
GCTAAAACAAAAGCTCCAAGTGCACCTAAAGCTCAAGCAGAATCCTGGCATGAACAACCCCATGCTCGCCGAGTGGATCTACGCAACTTTCAAGGCCCGG
GTCAGCCGTGCCACACTCGCCCGATTGCGCAACCTGCCTTCTTCCTACTTCAGCCACGTCGACCTGAGTGCGACCAAGCGGCGCCGAGTGAAATTCCCTC
AGTTCGAGCGGGAACTGAGGGAATTTTTCTTTCAGAACGAAGCTAAAACGGCGATGGCTGACGACGTGCTCCTGCTGAAGGCGCATGAGCTGGCGGAGCG
CTTAGGAGGAAGAGGAGGAACAGGAACCCGCAGTTCAACCTGCCATTGCTCTGAGACACTGCATGGAGCTGGCTGCATTTCTGCTGCAATGCGGAGAGCA
GACTGACAGAGAACGAAGAGCTTTACAGACCGTGACCGCTTTGGTTCGAGAGACTACGGTGAAGGCAAAGCGGCAGCGAACTATGCACGATTTCTTTACG
TGCACCACATAATTATTTTAACTGAGTCCATTTTATATGAGTCATTGTAGTAGATGGTCACCAACAGGGCCTCATATAAACAGGTTTGACTGTACGTCAG
CCCTTGAAGAATCTTGTGCTTGATCTCGATGGGAACAGCGCGTGAGACCCAGAGCACGATGTCGCGGTCCTCCTCTACGTAGCGACGGATGACTTGCTTC
ACCTTGATGTCCGCCCGAGAGCTGCTGGAGTAGACCTCCTTCTTGAAGTCTGCGATGATCGTGTACGGCTCGTCGAGGCCCTGTTCCCCACATAAAGCAG
CACACAAAGCAACTTGTGAGTGTTTGGCAGGACTACAATCGAGCAGTTAGGACGACAGACACCAACCTTCTCCGCCTTCTCGTACAGATTGCCGTTAGCT
AGGTGCTTCTCGACGCCTTTGAAGTGGATCCACGTAGCTTCTGCAGTGGCACGCACGTCGAAGGGAAGCACCTTGTAGCTCACGAACTCAAGAGATTTAC
CGTCGGCGCCCTTGAGGACGTGAACGTCTCCAGGAGGTACCGTCATTCCAGCCAAACCGTTCGTCATGAACACGTTGTCCACGTTTCGGTACGCATCGTC
CAGGCGGCTAAAAAGGCCTCGAAAGCCCTCCAAGTCGCCATGGAAGTCGAGCACATTGAAGGAGTGGTGACTGGAAGGCGCCGTCGTGATCAGAGACGCA
CACTCGTTCGTCTACAAGAAGGCAAACATGTTAACGTGATGGTCTCCCAACCGACAAACACTAGGAACAATATCCCACGTACCAACTGGGCCGCTCGCCG
TTGCATTTGCCTGGTCAAGTCGCTTGCCACCTTCCGTTGCCGCTCCACAGCGAGCCTCAAGAGCACGTTGTCTCGCTCTGCCACTTGGCGGCGGCGACGC
TGCTGGTCCGCCAGCCCCTGCCACATGCTCGTGGGCTGCGTCCCAGCGTTCACTTTGCTCAGCGCATCATGTCTTTCCCCCTTCTTCTCCGTGCTCTGGG
TGGTATCCGTGTTCTGGTGCCGTGTCTGCAGAATCTGCAGGTCGATCTGCAGCTTCTCCGCCTCCTCCCGCAGTTGGGCGATCTCGCGCGCCGCTCGTTC
CGCGCCCTGTTCGCGTCGCCATAGACCCCCGCCTTCCGCAGCAGCTTCCTCCTCTCGTTGAACTCTACCCTCCGCCTCTCTTTGTCTTCTGCGCTCAACT
GGTTCCTCCCTCGACCTCCGTGGCGTGTGCGCTTGGTCCTCTGCGGATCTTCAGTCTCCAGCGCCCATATATCCTGGTTGAACACGCCCCAGCATGGGGG
CGAGGCGTCGTCCGCCACTGACGATCCAGACGCGAACTCGTCCAGGAACGACAGCGCAGCCTCGAAGGCGTCGTCGTCATCCTGCAGAAATGCCATCGGG
AAGTGCAAAAATGCGTCTAATTGTACACTGACGAATATTGTCATTAATTTCTAGCCACTTTTGGCTATGCGGCTTGCCACAGCCTGGTCAAGGAGGATGT
TCTCAATGCACTCGCGGTGTGAGCGGATATTTTGTGCGGTGTTCGCCACCAGAAAGTTGGTCAGAGCATGCAGATTTGCTGTGCCGAGCTTCATGTGGGC
GTCTCGGTCAAGGGAAATCAGCGAGCACTGCTGAAGTTCCGCGAGCTCATGACCTGTGGTGGAGTCCAGTGACCGCTTCGTCACTGCGTAGCCGCGAAGA
TAATATGTGAAGCCACGAAGTAGCTTGTGCTTAATCTGGGCGGGCGCTACTTGTGCGACCCAAATCACGACGTCGCGGTCAGTCTCCATGTAACGCCGCA
CGACTTGCTTAACCTTGATGTCAGCTCGAGACGTGTCAGCGTATAGCTCCTTCGTAAAGTTTTCGATGATCGTGTATGGCTCGTCAAGATTCTGTGGCCA
TGGAGAACACAACGCACAGTTAGCTCTGTATCAATGCAGCCAGCGCCAACTTCAGTACCTGGCACCCACCTTTGCAGCTTTCTTGTAGAGACTGCCGGCG
CCATAGTGTTTGTCGACTCCTTTGAAGTGTTGCCAGATAGCCTCGGTAGTCGCGCGCATATCAAAAGGTAGCGACTTGTGACTAAAGCACTCGAGGTATC
TGCCGTCGACGCTTTCGCGCAAGTGAACGTCACCGGGGGAAAGCGTCGGGCTCGCCAGACCGTTGGCTGTAAACACCGCATCCAAGCCCCGATACGCAGT
CTCCAGGTGTCGGATAAGCCTTCGAAAGTCTTCTTCCATGTCTCCGTCCACATTCAGCACGTTCACGATATGGTGCTCTAAGAATGGTTGGCTCGTCAAA
GCTCCACACTCCTTCGTCTAGAGCGCCAAACCACCACACCGTTAGCTCAAGCTCCAGACAAGCTAACAACACGAGAAGATAACGCAGCAAACCTTACCAC
GAGATCAGCTCGCTTTCTTAGCAAGTCGCTCAGCGCCTCCGCCAGCTTCCGCTGGTGCTGCACAGCAAGCTTCAGGCGGATGTTCTCCCGCTCTGTCTCC
TCTCGACGACTTCTCTGTCGCTTGGCTAGTTCTTGCCACACACAAGGGGCTTGCCACGTCAGCGTGGTCACGCTTGTTGCGCCGGACCGTTGTTGTCTCT
GCGGTCTCCTCGCTGGCTTGGTCTTCACTTTTTGCAGGACCTGGAGGTCGAGCTGAAGCTTCTCGAGCTGCTCTCGAAGGCACGCGATCTCTGCCCTCTG
TCCATTGCGCGCGCGATTGGGGTCTGCGTAGACGCCGGCCTTGCGCAGCAGCCTCCGCCTCTCGTTGATCTGCTGGCGCCGCCGCTGCTTGAGCTCATTC
GGGTCCACGACCACTGAAGCCGAGGACCGCGGCTGCATCGACGCGGTCCCTGGGAGCTGTTCACTGGAGGAAGACCCGCCAGTGACATCTTCGTCAAGCA
CAAACTCGTCCACGAAGGACAGTGCGGCCCGGAAGGCCTCCTCGTCGTCTTCTGAGGCCATGGCTTATCACGGTTGTAAGTAAAAGAATAACGGAAATGA
AGGGGTTCGTGATAACGAATCGTGACAGCTGTCCTTGATGACACTCGCAATGAGCTCGTGTGGACGCGAAGAGGGTCATGATGAGTTCAAGAAGAGTGCG
ACACTTTTGTTGAGAGTTGCAGTGCGTTTCGGTCAACTTCCGCACCAAAGTTCCTTGGCCAATACAACATAAATTATCAATCAATCTATCCTCCAGAAAA
ATGCCCTGACGGGCACGAAGAACTTGCGCAAATTTCAGCAAAAGCTATTGTTCAGAGGTATTTTAGTAGCGAACACTGCCTTGCATGTGGCGTGCGATGG
CTTGGTCAGCTAATGCATTCCCGATTATTTCGCAGTGTGCCCGTGTGTTCTGTGCTGTGTGGGCGACGAGAAAGTCGATAAACGCGCGGAGGCTACACGC
GTCGCAAACCGCCTCGATTTCTGCTTCGTCAAAAGAAACCAGTGTGCACAACTGCAGAATGGACAGCTCGTGCTCTGGGGTTGAGTTGGGTGCCTGCATT
GTCACTGCGTAGCCCTGCAGGTGATATGTTAGTCTGCTCAGCAGCTTATGCTTGATCTCTACAGGCACAGCTCGATAAAACCGGATCACGACGTCGCGCT
CAGCTTCAACGGAGCGTCGAATGACCTGCTTGATGCGGATATCGTGTTGGAGTACAGCTCCTTCGTCAAGTCTTCAATGATCGTGTACGGTTCGTCCAGA
TCCTTATCGACGCCAAATACAAAGGTTAATGAAGGATCGATACCACCACCACAACATAGCCCACCTACCTTTGCTGCCTTCTCATAGAAGTTCCCGTACC
CTAAATGTTTTTCCACACCGCGGAAGTAATCCCATGTAGCCTCTTTCGTTGCTTGCAGCTCGAATGGAAGAACATTGTTGCTGAAGAATTCGAGGTAGCG
GTATTTGCCCTTGGTACTCTCTCGCATATGAACGTCGCCGATCGATATATCCATGCTTGCAAGACCATTCGCCTCGAAAATGGAGTCCATATCTTGATAG
GCAGCAGCGAGATGGTGGAATAGCTCTAGAAAATCGCTGTTCCCTGCGCTGAAGTTCAAAGCTCGTACGATATGATGGTCCGGATGAGCAAAGTGATTCA
TCATCGACTCGTACTCGTTGGCCAGCTGGCGTGCTCGCTTCCGAGCCAAGTTGCTGAGATCGATTGCCAGCTTCTGATGGCGCTCCACAGAGAGTCTTAG
GCGTAAATTCCTGGTCTCTGCTTCCTCTCGACGGAGACGCTGTCGCTCTGCTAGCTTCTGCCACATACTTGGAATCAGAGGGGCCGACGCGTTCACAGGC
ACTATGACTCTTGAAGCCTCCGATCGCCGGCATTGTAAGATCTGCAGGTCAAGAGTGAGTTTCTTCAGTTCTTCTCGAAGGAAGGCAATCTCTCGCGTCT
GCGCGTTCCGAGCCTTGTTGGGGTCGCCATAGATGCCAGCTTTCCGAAGCATTCTCTTCCGTTCGTTTATCTCCGCTCGCTTCCTGGCCTTCGCTTCGCG
TGAAGCTTTCCTTGCGCGTGACTTTGATCGAGTCGACGGTACGCTCTCGTGAGCAGTTGCTAGAAGTGTCTCGTTACCGTCGCTCTCATTGCTGCGCTCG
AACTCGTCGATGAAAGACAGCGCCGCCTCCTTGACTTGCTCGTCTTCATCTCCCAAGAGTAAATTCATGCCTTGCTTCCTCAGGGAGTTAAAAAAAAAAA
ACGGACCTCCTTGAGGCAGGTCCGTTCGAGCAGTGCTTGAACAACAGTGGAGACGCAACTCTGCACAGCTGTCTCATCCCGGATGATCAAGTACCCGCCA
TGTCACTTGATAAGGGGTGAGGACATCGAGGTCTTTCGCTTTCTTGTTGGAGTGCACTTCTCCACTTGAGTCTACGCAATTCTGCCGATAAAGTGTTACA
AAGCACTGCTGAAGAGTGAGTATTTATACATGTACTTGCATTTATACAAGTAGTTCCCTTATTGCAATCGCTGCCTCAGCACTCGATCAGCTAGATTGTT
CTCGATGCTGTCTCTGTGGGCGACGATGTTCTTCGCAGCATGAACAATCAAAAAGTTCGCGAGAATGCGAGCGCTTTCCGAGCTGTAGATTGTGTCAGAA
TCCTGGTCGAGAGAAATCCTTGAGCAAAGCTGTAGCTGCGTCAGCTCTTGCTCCGCCGTCGCCCGTTTTGTTATCGCGTAGCCAAGGAAGTTGTAGGCCA
GGCCGCTGAGTAATTTGTGTTTAACTTCCACAGGCGTGGCGTGGGACACCCAGATCACGATATCTCGGTCCGCCTCCACGTAGCGCCGTACAACTTGCTT
CGTTTTATAGTCCGCACGAGAATTGTTGGAGTACATTTCAATAGAGAACTCCTCGACGATCGTGTAAGGCTCGTCGAGATTCTATCGCCAGACCACAAGA
AGGAGGAGGTTAGTCCATGCAACTGTATCCTCGCTCTATCTATTGCGTACCTTCGCTGCTTTCTCGTAGATTTTCCCGACGCCCAAGTGCTTCTCAACGC
CTTTAAAGTGATCCCACACCGCTTCGGTTGCTGCTCTCAGTTCGTAAGGCACGTCCTTATAGGTCGAGAACTCAAGATACCTGCCATCTACGCCTTCGCG
CATGTGTACGTCGCCCGGAGAAATCGTGGATCTGGAGTCCATTGGCTGCGAAGACCGCATCCACCTCCCGGTACGCGTCGTCGACGCGCTGGAAAAGCCC
TCGGAAGTCGTCGATATCGCCACAGAAGTCCAGCACATCGACGGTATTTTGCCTTGAACAGCACAAGTTCATCAACGTCGCGCATTCGTTCGTCTGGCCA
CAATCACAGCAACAACAAGTTAATGCGTTCCTGCTGCGTTGTAGCGTAGCTACAATCCCCATCATCGTACCAATTGGTTCGCTCGCTTCTTCATCAAGTT
CTGCAGACTGTTGGCCACCTTCCGCTGCCGCTCAACGGCGAGTTTCAGGCGGACGTTGTCACGCTCCGCTTCTTCACGGCGCCGTTGCTGTCGGAGCGCT
TGGTCCTGCCACATACCGGATATCTGCGACTTGCAGCTCTTGCGAACCAACGCGCAGTCGCTCTTCGACTTCGTACCGTCTTGTCCCTGCGTTTGTCTGC
TCTGCAGAGTGTGGAGGTCGATCTGGAGCTTCTCGATCTGCTCGCGCAGGAGCGCGATCTCCCGCGTCCGCACGTTGCGAGCTCGGTTCGGGTCGCTGTA
GATGCCAGCCCGGCGAAGCAGCTTCTTCCTCGCGTTGGCTCTCGCTCTCTTGGTCAGGGTGTCGTCAGCGTGGACAGTCGGCTTCCTAGTGCCTGCCTGG
ACGTGGGATCTCACAGCCGAGAACGAGGGCTCGTCGTCGAGCTTGAACTCCTCCACCGCTGTTGAACAAAAACTCTGCAGGGACGCCTGTCTCAAGAGAT
ACCGCTCAGGTTGCTGGAAGTGTGCAAGTACATGAACAGGAACAAGGTTGAAGGGTCCGTGTATTATCTACTCCGTCAGTCTCAGTGCTCGGTCTGCTAG
GGCGTTTTCGATGCGTTCACGGTGCGAGAGGCTGTTCTTGGCGGCGTGGATGATGAGGAAGTTTTTGAGAGCGCGGGCGTTGTCGGGGCCGTAGGCTGCG
CCCTCGTCTTCGTCCAGCGAGATCATTGAACACATTTGCAGTTGACTCAACTCGTTGTCGGCTGTGGACGCAGGAGAGCGCCTCAGATGGCGTAACCTCG
GAAGCTGTAGACCAGGCCACGAAGCAGCTTGTGCTTGACCTCGACCGGCGTGACGTGGGAGACCCCGATGACGATGTCCTGGTCGTCTTCGACGTAGCGC
CGCACGACTTGCTTGAGCTTGATATCGGCGCGAGAACTGTTCGAGTAGACCTCCTTGGAGAAGTCCTCAATGATCGTGTACGGCTCGTCGAGACTCTAGT
CAGCAGCGATTTTAAAACGTTAGTTAGCATTAGTGTTGCTAAGCGAAATGAGCTTGAGCGTGCTAGCACGCTCACCTTTGCTGATTTTTGGTACAAATTG
CCGTAGCCTTGGTGCTTCTCCACGCCTTTGAAGTGGTCCCAGGAAGCTTGAGCAGTGTCTTGCACTGCGAACGGCAGATCCTTGTACGTAGAGAACTCGA
GGTATTTCCCCTGGACGCCTTCGCGTACATGAACGTCGTTAGGCGAAATCGCCATACTTGCCAAGCCATTGGCAGCGAACACTGAGTCAATGTCCCTGTA
GGCAGCATCGAGGTCGCGGAAGAGCTCACGATAGGTGCCGATATCCCCTCGAAAGTCCAGGACGTCGAAAGTGTTGCGCTTTGAAGAGCACAAGCTCACC
AACGACGCACACCCGTTCGTCTGCAGCAGAGTAAGGGGGGATCAAGTTTGTTCTCATCTTCCACCTGAGGAACGAGTCCCAGGTTCTTACCAGCTGACTC
GACCGCTTGCCCATCAAGCTTCTCAGGCTGGCCGCCACCTTCTTCTGTCGCTCCACAGCGAGTCTCAATAGGACATTGTCTCGCTCAGCCTCCTCGCGGT
GACGTCGCTGTCTAGTAGCTTGCTCTCTCCACAAGCTCCCTGGTCCTGAAGCTGGATGGTTTCTCGCAACGATAGCAGAGGCATTCGCCCGCTTGGCTTC
TCGCTGCTCCTGAGCCCGTCGGGCCTGCAGAACCTTCAGGTCGAGCTGCAGCCTCTCCATTTGTTCGCGCAGGAAGGCGATCTCCCTCGTGCGCTCGTTC
CGGACGCGGTTCGAGTCGCCATAGATGCCGACCTTCCGCAGGAGCCTCCGTCTTTCATTGATCTCATTCTGGCGCCACCTCTTCTCCTCGCTCGACGACG
AGCGCTTGGTCAGAGCCTTCGACTGAGTCGCGCGCGCAGTCTCAGCTGGTGCGTTGTCCAGGGGGGAAGGCAGGAGCCCGTCGCCTGCCGCCTCCTCGAA
CGAGAACTCCTCTACGAAGGACAGGGCCGCCCTGAAGGCTTGCGTGTCGTCGCCGTCCTCCATCTTAATCACGTGTCTGTCAGTCACTCACTCACTGACA
GTTCTGCGCAACTGCCACACACGGCGCAGAGGAGCTCATGTGAATCATGGGATGGGATCACCCTGCGGTTGAGCAGCGCAACGCCACCGCCACCAACTCG
GTGATCAACGTGTGCTTGCGTATATATCGTGTAGAAATTGTATTAACGGTTTACAGTTAGTCATGTTAATTGCCGCGTGAGCGCTCGCTCGACGAGCGCG
CTCTCGATTCGGTCTTGGTGGGCCTGGATCTTGAGCGCTGTGCTGGCGATGAGGAAGTTCGAGAGCGCGCGCATGTTCTCCGGGCTGTACTTGGCCGCAG
CGTCTTGGTCGAGCGAGATCATGGAGCAGCACTGGAGCTGCGAGACCTCGTTGAATCGTGTTGACGTTGAAGACCGCTTGGTCATTGCGTAACCACGAAG
CTGGTACGTGAGCCCACTGAGCATTTTGTGTTTGATCTCGGCAGGCGAGACGCGCGCCACCCAAATGACGATGTCTCGGTCAGGCTCCACGTAGCGTCGG
ATGACCTGCTTCACCTTGATATCTGCGCGAGACCGTCGGGAGAATAGCTCCTTGGTAAACTCCTCCACAACCGTGTAGGGCTCGTCAAGGTACTGAATAG
GAATACGATTGTTAGAAGCTAGACAGATAACTCTTTGACCATGCTTCAAACACTTGAAGCCACGAACGTACCCTTGCAGTCTTCTCGTAGATGTTCCCAT
TTCCTAAATGCTTTTCGTTCGCTTTGAAGTGGTCCCATGTTGCCTCAGCCGACACCTGCAGGCCGAAGTGAAGAACTTTATTCGAGAACGCTTCGGCGTA
GGTTCCGTCTCCGCCTGCTCGGATGTGGACGTCGTCCGAGGTTTCGACCATGTGAACGAGCCCGTTGACTGCAAACACGGCGTCCACCTCCTGGTAGGCG
GCTTCGAGGTGTCGAAAGAGCTCCCCGAAATCGCCCATGTCTCCACAGAAGGCCAGCACATGAACAAGAGGATGCTGGACGCAGTTTTGCCTGATGAAGC
CTGAACAATCGTTCACCAACCCAGCCACTCGCTTTTGCAGCGAGCTAGTCATGCTGTCCGCCACCTTCCGCTGCCGCTCGACGATGAGCTTCAGGCGAAT
ATTTTCGCACTCCGCTTCCTCCCGACGCCGCCTTTGGATGTCCAGCACCGCCTGCCACATCTTGGAATTCTGGGACGTGCTCGACACTTCTCCATATGAA
GACTGCCCCGACGACGTGCCTGCAGTCGTTGAGAGTCTACCGACCTTCTTCTGCTTCTTCAACGTCTCCAAGTCAATCTGAAGTCGTTCCAGTTGCTCGC
GGAGGAAGGCGATCTCCCTCGTCCGTCCATTACGCACACGGTTCGAGTCGGCGTAGACTCCAGCCTTGCGCAGAATCCTCGTCTTCTCGTTGATCTCCAT
CCTCCGCCTTATCTTCTCTTCGCGCGACGTCACGCGCACCGGGGCTTTGCATCGAGCGGACTGGACGATGGGCACGCGGGCGTCGGTCGATGGCTCGGAG
GAGCTGCTGTCGCCCCCACCTACGGATACCGTCGAGGACTCGGTGCTCGAAGCGGACGCCACCTCGTCCAGCGCGCACTCGTCCACGAAGGACAGCGCCG
CCGCCGCCACCCCGTCGTCATCTTCGAGCAAGAACACCATGTCTCTCAGTGCCGTGTGCAAAGCATTTGTGCCTGGCTCAGAGTCTGTGTCGCATCCTGG
CAACCGAACCAATGCTTGGGTGGTTGTTTCGTGTCTTTACTGCCCAAGGCGACGAATTCACTTTGCTCTTCACTTTGGATTTACATTATGCGGGCGGGAT
GATCCCCTGCCGCCTTAGCTGTTGGTCAATGAGCGCGTTCTCAATGCGGTCTTGGTGCGCCTGCATCTTTTGGGCTGCTGTGACGATGAGGAAGTTGGTG
ACGGCACGGACAGTCTCGGGTCCGTACATCGCCTCTGCCTTGGGCTCGAGCGAGATGAGCGAGACGCACTGCAGCTGGGAGACTTCGTGCTCGGGGGTCG
ACGCTGGCGATCTCTTGGTCATCGCGTAGCCTCGAAGGTGGTAGGTCAGTCCGCGCAGCTTCTTGTGTTTGATCTCGGCCGGCTCCGCGACGGAGACCCA
GATGACGATGTCGCGGTCGGGCTCCATGTAGCGCCGGATCAGCTGCTGCGCCTTGATATCCGCGCGAGCGTTCTTGGAATGCATCTCCTTGGTGAACTCC
TCGAGGATCGTGTACGGGTCGTCGAGGTTCTGTTAGAGAAGAATGACAATGTTAGAGCGATCCACTCAGATATTATCGATGTCGGTGCTTCTGGGCGTAC
CCTGGAAGTTTTTTCGTAGATAACTCCATTCCCAAGGTGCTTTTCGCCTCCTTTGAAGTGGTCCCATGTAGCTTCCGTTGCTGCGCGCAGCCCGAAGGGC
AGCACCTTGTTGGAGAAAGCCTCGAGGTATTTGCCGTTGACACCTTCTCGGATGTGGACGTCGCTGGGTGTGAGCACCATGTTGGCCAGCCCATTGGAAG
CAAACACGGCGTCGACCTCCTGGTGCGCAGTTTCGAGGTGGCGGAACAACAGCGGGAAGTCGCCTGCAATCCCGCGAGAGCTCAACATGGAGAAGTCCAC
ACTCATGAACGAAGCGCAGTCGTTCGTCTGTAGTCCAAGAAAGAGAGCACACAAAATAAATTGTAAGCAACGCAGCGTAGATTAAGTAATACAAGCCATG
AACTACGTACCAAATGTCCCGCTCGCTTCCGCACCAAGTTGGTCATGCAGTTCGCCACCTTCTGCTGGTTCTGGACGGCGAGTTTCAAGCGAGAGTTTTC
ACGTTCTGCCGCCTTCAGTCGACGCTGCTGCCGAATGGCGATGTCCTCCCACACCTTCGGGATCTGCAGCGCGTCGTCTGTTGGGTCCTGCGCTCCAGGT
TGGATGGCTGGTCGTCTGCTCTTGCGACTCTGCAGCACCTGCAGGTCGAGCTGGAGCTTCTCGATCCTCTCCTGGAGGTAGGCGACCTCTAGTCTGCTGT
CCTTGCTCATCCAGTTGGCGTCCTCGTAGATACCGGCCTTGCGCAGCAGCTTCTTCCTCTCGTTGGTCTCCGTTCGTCGCCTGAGCTTGTCTCTGTTGGA
CGCTCCGGGTTTGGCTGCGAGAGCTGAGACGGTGGCTGCCATCTCGTAGCCGCCGAGAGCCCCCAATGACGTCTCGACTCCGCTGATGTTAACTGTCGGC
GCCAGGCCGCAGGACATGGCGGCCCACTCATCCTCGCGCTGCATCATGGCGGTGGTCCTGAACGCTGCAGCATCCTCCAGCTCCTCGTCATCCAGCACGC
ACTCGTTCACGAACGACAGCGCCGCTTGGAACGCGCGGTCGTCCTCGTCCACGAGA