Description :
From Genome Similarity Track
Location :
contig_14:81765- 85075
Transcript NameFunction/comments
g3462.t1hypothetical protein

Sequence
3310 bases(100 bases per row)
AGCTTTGACGTCGAGACGGAGGCAGGTGACTGTGAGTACCAAGTCTCGTTCTGGGATTTCGCAGGCCAGGAAGAGTATCGAGCGGCGCACACCTTATTTT
ACTCCTCTCGGACGCTCTACTTGCTGTGCATCAATCTTGATCGCTACCATAACGCGCTCACAGCAGCTTCCGACTCGATGGACCAAACCGTTGATGATCG
CATGATGGATGCGTTTGCAGACATTAACGTTTTCAGGTGGGTGCGAATGATTTGCGCTCACCACCCTCAAGCAGAGTTTGTTTTCTTGGGCACGAAAGCC
GACCTCCTTCAGCATGATCGCCACAAAATCATCGCTGTCCAACAAGATATTGTGGCTCGCTTCAATTCCAACGTTCGGAGAATGAAGGACCGGGTGCAGC
GTGCGCTGCAAGAACTGGAGGATGCCAGGTTTGAGATTCAGGACAACGACGCCGGTGCAGAGACACCTGAGCTCGATGATCAAATCGCTGGCTGCGAGCA
GATTCTCCGTAAACAGCCAGGGCTTCTCTCAGAAGAGCTGATCGTTTTTTCGAGTGCTGACTTGAAAGACGAAAGCATCGCTCGAGGAAAGTTGAAAGCT
CTGCTTATGATGAGTGGCAGCTCCGTTTTGTTGCCCCCAAGTTACGCCGAGCTGCTGAAGCATGCTCAGCAGCGATATATGTCCGGCCAAAAGCACTTGC
CGTCATTTCAAGATAAAGTTGACACAGCATTCGTGTCAGTGAGCGAGTTCATTGAATCGGTGACCTGTGCGTCAAAGCTGATCATACCCGAGAAGGAAAT
GCTCTCTGCGCTGCATTTACTACATGACACTGGTGACATCGTATGGTTCGATGGTGTATCGGACGCTCGCCTACTGCAAGAGAGACTCTTCTTGGACCCT
ATGCTTGTGATCGAGTTCATCCGTCAGATAGTCAATCATAAAGTGGATGCCAAGGCATCTGTAAACGGCTACGTAAGCCACTCGCAACTCCAGTCACTAC
CTTTCTGGAAGGACGTTAGTTCAAGTACAATTCAGCAATTGAAGGAATTGCTGCTGCATCTAAATCTTGCCTATTCGGCTGGGAAGTCGAAAAAAATGGT
GTGGAATTCGGATTTGATCATACCTGTGTATTGGAATCGCTCTCCGGGACCTACAAGCTCAACCGATGTTAAAACATTCTCAACAGAAGAGGAGAAGTCT
GTTGGGTTAGTCGAATGCGTTCGATGGGAGTACTCATTCGAGCCTGCCATTCCTGAAAACCTCTATGAGAAGCTGGCGGTGGCGACGTATTCACCCTTGC
TTCGATCAGAGCGAAAATATGGTGGGTCAAGCTTCATTGATAAGGTGGTAGATGAGTACAGTGCCCGTGTTGCCAAAGAAGAAGACACGTCAAATTTCTC
AGCACAAGAAGTTGTGGACGCCATCGTTTCTGTACTAAGTGTTAGTGTTGCTGCTCAAGATCGGACACTTGCGTGGAAACAGCTTGTATGGTACTGCATG
AATCTCGAGAGTTTGCTCAAGACATATCCGGGCTTGCTAGTGACGCGCTGCACAGTGAATCAACGAGGTCAGCGGTTCAATGTTGATCAGCTTCTTAGTG
ATCAAGAACATTTCATGCAGCTAAATATCTGCACAGATCAGGAGTTTCTGCCAGCGGATATGGACTGGTACACCAACAGACATCGCCACCAAAAGCTTGC
TACCGACACTTCGAAGGCTTTAGTTGGACCTAGCGAGAACGCTCAGGCTGCTGAAATGGCGCTACTTCGACAGGATATTTACAAGCTTTCGACCACCGTG
GAAAAACACTCAGACGACATGGATAGACAATTTCAGCTCAACGGGGAGCACATCGATGCCGCTGTAGACGCTTTGAAGCGTTCTCAGATTTCGTTAATCA
CGGGGATGCAGAACAAAGCGAAATTTCCTTCGCTCTGGACACTTGAGTACCAAGGTTTTGACAGCGAAGGCAGTATGGCTTCCAGCTTCGTGACTTCCCT
CCAGAGAAAAGTGACAACGACGGTTATCGTAAAATTCCGAAGTGAGCTCTCTGGAAAGTGCTACCATGATCCGATCGCCATTCCCGCTGCTAGAGAAGTC
TTTTCACGTTTTGGGAAATTCCTCAAGGTACGTTTTATCAGAACGGAGCACCATAGACTTGTCTAACTTGTGATTTTTCTGTCTAGGTGGGATTAACCCT
GCTTTCCGCTGCAGCCCCGGATTTCGGTGGGAAGGACGTCCTCGGGATCATTACCGACGGTACGATCTTGTTTATCGAGGCGATGGCAATGCATTGCTAA
GTATTGAATGATTCACCGCAGAATGCAAGAGGCAGATTGACAGGAGCACGGAATTCCACGAGGTCTTGCACCGTGCTGGTATCTCGGATGACCGAGCAGT
ACGCTCTCAGCAGATGGAAACTAACCGGGACCTCAGCCCCTACGAAGTCTTGACTCTGCTTAACTGCCTGCTGAGGCTACACAACCAAGACTTTCAACCA
GACGATATTTCTCAGCTTTCCGGTTTGGTCTGCGGCGTTGTTGTGCAGACAAACGAATACATTTGGGCTTCTCGCAACGAGATTTTGCAGCACGGAAAGG
ATATCGTACTGGCCGTCGACTATTCGAAGCGACCAACGAAAGATAACGCGAGTACTGAAGAGAAAGCTGCACTGGGTACTCTACCTACAGTCGAGATACT
ACCACCAATACTAACGGAGACACTATCAGAGCTAGTACCAGCTCCGACGGAGCGAGACTCTTCGATTATCTCCAGCGCCAAAGCGGATTCGCCTGAAGAC
AGCGTGGCAAGTAAGGGGATGCTTCAAGCTATGAGACGTCGGCTATCGTCATCGAAAGCAGCGGTTCCGACTGCAGAAGTGCAGCGTTTCATGCTAATGA
TCATCGGAGCTAAAGGATTGCATGGGAGTCGCAAGCAAAGCCCATACTGCATCTGCCGCTTAGAGTCACCTAGTGGTGCGCCTTTGCTTCAGGTTCAAAC
CTCTCCCCATTCCAATGGCGGGCAAATCCATCGTGGAGCTCACAGCTTTTTGAGGTGGCGCTGCCAGTGGAGGCAACACGCGACGCAAGGATAATATTCA
CAGTCAAGAGCGGAAATGCAGTGGCCAGCACACGAGTTGGTCAAGGAAGCACACGTTTCGTGACCTTGAAACTTGGCCAACCCACCACCCAGGAGGTTGG
CTTGACGAAAAAGGGCAAACCTGCAGGAACGCTCGAGTTTTCTCTGGAAGCGTTCGCTTAAGAACAGGTCGCTAAATTGACAAGAACTAAGCGAAACTAC
ATATTCCAAA