Description :
From Genome Similarity Track
Location :
Scaffold_150:8176- 9955
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_150-abinit-gene-0.35FUN14 family protein
Pytiw_DAOMBR242034maker-piw_contig_150-fgenesh-gene-0.7Conserved gene of unknown function

Sequence
1779 bases(100 bases per row)
TGTGTGTGCGGCTTGCAGAGCGCTGGGCCATCCGGCAGCGGCAGTGGCAAGGGCAAGAAGGACGACGAGTACATCAACTGGCTCATCGACCAGTTTACGA
GCCGTATTGGAGACATCACGCTCGGCAGCGGTCTCGGCTTCTGCTCCGGCTACGCGTTGAAGCAAGTTGGAAAGGCCGCTGCGGTCGCCATCGGAGGACT
CTTCCTGCTCGCCCAGGTACCTACGACCTCGATCGCGCCTTTGTTACGATCACACAATGGATAAACGTGCTCACTCTCTCTCTATTGTTGATTGCACACA
GGTCGCCGCGTCCAAGGGCTACATCGACATCAACTGGAAGAAGGTCGAGAAGGACGTGATCACGGCCGTGGACCCGGACGGCGATGGCAAGATCACCAAG
AAGGACTTCCAGATCTGGTTCCAGCGCCTCGTCGCGACGCTCAAGTACAACCTCCCGTCGTCGGCAGGCTTCACGGGCGGCTTCGTGCTCGGCCTCACGT
GCTCGTAAACCCAGCAGGGGCTACTTCCTTTTTTTTCTTTTGCAACAAACCGCGTCGTCATGATTTGCTTGTTGGTCCATCAGAAGCCTTCGTAGCATTA
ACAAATCATAAACCCGGCGGTGCTCTTTTCTAAATTACACAAGTACGGACGGACGGGAACTCGCTTTGTAACTCATTCACACGGGAACGCTCTTGCGAGG
AAGCCGACGATGACCGTGCGGTCCTCGGCGCTCACGCCCATGTTCTTGAGCTCGCGCGAGAACGCCGGCACGCTGCTGATGCCGTTGCTGATGAGGTTGA
GCCCGAGCGCCGAGTGGAGGATCACCTCAGGGCTATCGAAGGACAGGAACATCTGCTTGGAACTCTCCGAACAGGTCGGGAAGCAGTCCTGCCACATCTT
CTCCCGGATGCACAGCTGCGACGCCTTGTCCGGGTTCTGCAGAGCATAACGGCGCGTGTGAGTTGCTTGGCGACAGACAATTAGACCTGCAGATAGAGAC
TCACAGTGTTGACCAGGGGGATGCCGTCCATGTCGCCCTGCGACTGCTACAATATCATACATGGCTCATCGACGTTAAGCTGGTAGCACTTCCATAGGAG
AGAGGGCGATTCGTACCGCTATCAGCGCTTGCGTGCGGACACTCAGTCCACTCGCCGGCAGGTCCAGCTCCTATGAAAGCATCATACACCAGTACCATCT
ATAGAGTGAGCTGTCATTGTCGCCCATGACATGCCGCGCTGAATAAAACGTATATATATATGAGCAGTTCTCCACCCTCACAGTCGCGTCCTTCTCAATG
TAGATCTTGTACGCCTCAGCGGTCGACAGGCGAACGCCATACAGCGTCGCTTTCCACTCCTGCACACGCAGCACAAAGATGCGTGAGTAGCTCTACAGAC
ACATCTTTCAATAATATAGCGCGCCTTCGTACGCACCTCGGTCTCGTCGTCGTCGTAGTCAAACTCGATGGGCGCCAGCCACTCGCGCTCCACCAGCTTC
TCGAGGATGCGCTGCGCGAGCGCGTACCGCGGTCCTTCCTCTGCGCTTCCATCCGCCTCTGCGCCGCGGTCGTCGCCGGCGGCCTGCTGTTCACTGGAGC
TGGAACTCTTGTCGCCGTCGCTCAGCAGCAGGAACTTGTTGCCGAAGAGCTCAATGCCGTCGCGCGCCACGAGCCACTCGAGTAGCATCTTCTTCTCCAG
AAACTCCTGCCCGCCGTCGTCCGAGATCTCCGTGATGCCCGCGTGCTCCAGCAGCACGACGAACTCGTCCTCGCTCATG