Description :
From Genome Similarity Track
Location :
Scaffold_550:8176- 9646
Sequence
1470 bases(100 bases per row)
CGCTCTACCTTCAACTCGCCCATTTTCTTCACCAACCGACCACGATCGGCATCGCGATCGGCGAAATCCAAGTTAGCCGATCGCGCTGAGTCGTGAGATC
TGAAATCTGAGCTGCGAAGCTATCGCGCTCAGTCTTGATTGTACCCAAGTTTCGCTGGGACATGGCTAACTCCCGCACGATTGCGGACTGGCGGGCGGCA
AATCGGGTTTTCGCGTTTTTGATCTGGAGTTTCGCCTGACCATCGGCATCCTTGGAAGACGCAATCGCTGATTCCAACTCGATTTGGAGTATAGCCAGTT
GACGCCGATGCTTCTCTTTTTCGGCATGGCGGGCCGCTTTAAGCTTCAGGAGGGAAGATTTCAGGATTGGAATTTCTTATAGACGTTCCTTGATCAGCCA
ATTCCTCTTGGAATTCAGCGATTTTCTGTTCGGCATCAGCCAACGAGTCACGCATATTGTCGTACTGCTTATTCACAATTGCCGGATCGGTCCTTCGAAT
TATTGAACGTCGCGCTGTTGGCGTTCCAAGCGATCGCCGCGAATTTCTTGAGCTCTCAACTGATCGTGGATTGCACTGTAATCGGTTAGCTAATCTTGAC
GGGCCTCAGCGCAGTCGTAGAGATCGTCGATATACGTAAGGTACGCCGATCGATCACAGGGAGAAAGCTCACGCGGCCGCTCGGAAACGAAGACGAAGAA
CGTAAAGAAACTGCGGCCGGTTGCGAGGAGCTTGAAGCTTCAGGCAGGCCCGGGCAGGTGATCGACTGATCACCAGAAGAACGTGGGGCGCTGTGGCCGG
CGGGGAAGAACCTGAAGCTTCCAGTGGACCTGGGCAGGTGATCAACTGATCACCAGAGTCGTCCATGAAGAACAACGCGTAAAGCAGAACTACGGAGATG
GAGATTACCGATGACGAATTGCACAGACACACCAACACTGTATGTCGGTTAGTAGTGCATGAGACGGCTGTGGTAAAGCGGATCGAAGCAATCAGGGGCG
ATCGTTGGGTGGAGTGATCTCAAACCACGACAGTTCATTGAGAAGGATCGATTGTCTGTTAATCTGCGCAATACCAAGACCGAATATCGCAATATCAAGA
TCGAATACCACGATACCGAGAGTGAATATCGCAATACCGCGATCAAATATTACAGCAACGGGATCGAATATCAAGTTGCCAAGATCGAGGCAAGATACCA
AGATCGGGAACACATAAGGTGTTCAAAGTCGGGAAGATGACCGACAAATTGGCAGGGATCACGGTCCTAGAGAGTGATCGACGATCAGGATATTGACGAT
TGATCAGAAGATGATCGAACAAGGAGATCGATGATCGAGGAGATCGACGATTGGTCAAGGAGATCGATGATCTATCATCGGAAGTGGACCACATATGCGA
AGGAACGATCAACGGAATGTAGAGGACACGTGGTATCATATCCTGGCATATAGACAGGCACACATGGTAG