Description :
From Genome Similarity Track
Location :
contig_75:81741- 82905
Transcript NameFunction/comments
g11783.t1hypothetical protein

Sequence
1164 bases(100 bases per row)
CGCTGGGGGTCTTCTGGCCGATCCTGGTCCGGCGCCGCAGTGAGAGCCTATACGACTTGAGAAATCGGAGGCGCCACGACGAGCTTGCCGAAAACTGGTC
GAAGCGAAGACCCAGCTCACCTGCTACTGCACGTGCCTTCATCTGGAGCATGAGCGGAGACACTGGTACGCCCTCGCGCCTCAGGTCCCTTATCCAAAAG
GCTAGGTAGTCCTCCTCCGCCCGAGGAAGAATGCAGCCGACGCCAGATCGTGGTTCTCTGCAGAGGTGCCCGTTGCCTTGGGCAACTTGTTTGGCGATGT
CATCACGGTCTTCGAACCACTTGTGCAGTTGCCGCTTCTTCCGCTTTCGGGCTTCCGCTTGGAGAGAGGGATAGAAGCGTGTTACTGCTGCTGCCATGCC
GTTCTGCTCGACGAAGCTATTAATAATATACTTGCGCTGGTAGCTGATAGCAGTGCGAAGGCACTGGCTTGGCGAAGCCTCGAAGCCTTTCACGCGTGGG
CGGCTTCCTCGGGGCATTCTTGCAGACTGAGTAATGGCGAAGTGCAGAGCTGATGAATGGCTAGCTCGCTGCGTAACCTATCGACTGGTGGTAATTTATC
TCCGGGGTGCCTTTTGATATGTCATGATAGATGATCAAAATGGAGTAATCTGATAGGTTGATATTTTTCAACCGTCGCCTGCAAGGGGTGCCTTTTGATA
AGAGTTTTGCGGTATTGGTGCGACTCGACCCTTAGCCGGGATCAAATTCTCCGCGACTTCGTCCAGGTGTTCTCTAGGTGTGATTCCTGCATCTAGGATG
GCAGGTAGTCCGTCTTCATCACGTTGCACTCTGCGGATCTCCAGATTCCAGTGTGACAGGATTACGCCCCACTTGACGTTCTTACCGTCTGCCGACTTGG
ATGTCAGTAGCCACTTAAGCACAGAGTATCGGGTGTATACTACGATCTTTGGACTGTGTTCCACCAGATTCCTGAACACTTCTAGGACTCGCATGATTGA
AATCACTTCCTTCTCGGCGAGCTGGTATCTCAGCTCAGCGTCGTTCAGGACACGCCCCGTGAAGCGAACCGGATGAATGACTCCATCGTACTCTTGGCCT
AGTACCGCAGACGCTACCCACTGATTAGCATGCGGGATGATCACAAATGGTCGTGTGCGGTCAG