Description :
From Genome Similarity Track
Location :
Scaffold_1055:8174- 11238
Transcript NameFunction/comments
Phypl_g12199P-type ATPase (P-ATPase) Superfamily

Sequence
3064 bases(100 bases per row)
TGCTCCAACGTGGTGATCACGTCCAAGTACACGACGTGGAACTTCCTGCCGCTCTTCATGCTCGAGAGCTTCCGCAAGCTGGCCAACGCCTACTTCCTGC
TCGTGTCCGTGCTGCAGTGCATCcgcagcatcagcaacaCCAACGGCCTGCCCTCCAACCTGCCcgtgctcgtcttcatcctggccgtggacggcgtgct
cGCCGTCATCGAGGACCGCAGGCGGCACCTCGCGGACAAAGAGGCCAACTCGGCCCAGTGccacgtgctcaaggagacgTTCACAGGCTccgccgacgcg
ctcaacCGGGCCGGGGGCGTGGACGACCCGGCCGTCGCGCTCATGCACTGGGCCGCGCTCACCGTTGGCTCCGTCGTGAAGCTCCACAACCGCGAGACTG
CCCCCGCGGACCTGCTCATTCTAGCCGTCGCCGAGCCCAACCCCAGCGAGCCCGCCGGCATTTGCTACGTGGAGACCAAGAGCCTGGACGGCGAGACGAA
CctcaagctgcgccacgcctgcgacgccacgctgcaCGTGCGAACCGTGGCGCAAgtggccgcgctcgccggCCAGCTGCGCTGCGAGAACCCCAACAAG
GCCATCGGCCGCTTCGACGGCACGCTGTCCGTCGCGGAAGgcgccaaggcggcggagacgcaCCCACAGCCGATCGCGatcaagaacgtgctgctccgTG
GCTGCCAACTGCGGAACACGGACTGGATTTACGGCCTCGTGGTGAACACCGGCCCGGACACGAAGATCATGCAGAGTGCCACAGCCACGCGTCCCAAGTG
GAGCTCCATCAACGAGACGGTGAACAAGATGATCATCtggctcttcctgctgctgtgcttccTGTGCATCATTGCCACGACCGTGCAGGTCATCTGGCTG
AACAGCAACGTCGAGGAGAGCTGGTACCTGAGCTGGTCGCCCGGCATGACGAGCCAGTGGTTCATTGGCTTTGGCTACTACTTCTTGCTCATGTACCAGA
TGATTCCGGTGTCGCTGTACGTGACGATTTCGATGGTCATGTTCATCCAGGCGATCTTCATGACCTGGGACCTGGACATGTACTACGAAGAAGCGGACGT
GCGGATGATTGTCCGTTCCATGGGGctgaacgaggagctgggcCAGATCTCGTATGTGTTTAGCGACAAGACAGGCACGCTGACGTGCAACGTCATGGAG
TTCCGCAAGTGCTCTATCGACGGCGTGTCGTACGGTACAGGTATGACGGAGATTGGccgcgcggcgctgcgccgaAAGGGTGTGGTGGTGCCAGCGGAGT
CAGAGCCAGACCCGGCGACAAGCCGTGCCAAGATTCCATATGTCAATTTCGAGGACGTGCGGTTGTTCAACGCGTTGGAGAGACCTacggacgacggcgc
gccgAACCGTGAAGCTGAGTTTTTCCTTCATTTGAGTCTGTGCCAGACTGTCATTCCTGAGCCGATGGAAGGCACCTCAGAAGtgcgcttctcggcctcg
tcaCCGGATGAACAGGCACTGGTGTCAGGCGCAAAGTTCTTCGGCTTTAGTTTCGAATCCCGTGGCTTGGGCGTTGCTCGTGTGCGCGTGAAGCGTCCGG
AGCTGATCGGTCGCTACGCGAACGGCGTCACTGGCCCGAACGCTTTGCTGGAATTCAAGATCTTGGATGTTCTAGAGTTCACCAGCGACCGTAAGCGTAT
GTCTGTTGTGGTGCAGTATCCCAACGGAGAGTACTGGGTGCTCACGAAGGGAGCCGACAATGTGATTTATCCTATGCTGGCGAAAGCTAATAGTGACCCA
GAAATGATGAAAGAGACGATGCGTCACTTGGAGACTTTCGGCGATGATGGTCTGCGTACGCTTACGATTGCACAGCGCCGCGTAGACGAGAAGGAATACC
TGAActggagcgcgcgcttcaagGAGGCCAACTCATCCCTGGAAGAGATTGACAAGCGTAAGAATGGCCAGCCCAACGAGATCGACAAGCTGATGACGGA
GATCGAGCGTGATCTAGAACTGCTGGGTGCAACGGCTATTGAGGACAAACTGCAGAACAACGTGCCGAGTTGCATCGCCAACCTCATGCGTGCTGGCATG
CGTGTCTGGATGCTTACTGGTGACAAGCAGGAGACTGCCATCAACATTTCGTATGCGTGCCAACTCATGGATAACGacatgcagcagttcgtctTCAACT
GCGACTTGTATCCGACCAAGGACGTCATCCTCGCCCAGCTTTCTGGTGCGAATGCGCAGGTgcaaggaggtggaggccgcCACGCAGTGGTTATTGACGG
TGAGTGCTTGGAGTTGACATTGGCTGACGAGCGGTGCCAGCACGAGTTCTTGTCGCTGGCTATGGCCTGCGAGGCTGTGGTGTGCTGTCGTGTGTCGCCC
AGTCAGAAGGCCGAGGTGGTCACACTGGTGCGCACTACTAACAAAAAGGTGCGAACGCTGGCGATCGGTGACGGGGCCAACGATGTGGCTATGATTCAGC
GCGCGCATGTTGGCGTGGGTATCTCGGGCCAGGAAGGTATGCAAGCGGTGAACTCGAGTGACTACGCAATTGGCCAGTTCTACTtcctggagaagctgct
gctgcatcatggTCGTCTGAATTACAAGCGCATGGCCATTCTCGCGGGCTACATGTTCTACAAGAATATTGTaatggtgctggcgcagtACTTTTACATG
TTCTGTACGGGCTCGTCCGGCCAGAAGTTCTACGGTGAGTTGGGGTTCCAGCTGTACAACATTTGCTACACTTCGCTTCCTATTATTGTGCTGGGTGTGT
TCGACTACGACGTGCCTTTCGAAGTGAGCAAGTACTTCCCGGAGCTGTACCTGGTTGGTCCGCGcatggagctcttcaacaACTACACCTTCTTCAAGTG
GATCTGCAGTGCTGTGTACGAGTCGGCCGTCATCTTCGTGTTTGTCGTCTACGCGTTCAACGAGAACTTCTCCAATGCAGGCAGCGCGCCGATGGTGCAG
TACGGATTACTTGCGTTCACGATGGTGGTTTTGGTGGCAAACATCAAGCTGTACATGCTGCAGA