Description :
From Genome Similarity Track
Location :
Scaffold_3:81731- 84024
Transcript NameFunction/comments
Hyaar_Emoy2800524hypothetical protein

Sequence
2293 bases(100 bases per row)
GAACTGGCGGTTCCCTTGCTCATCGACCAGCGTCGGTGGAGGTCGGTGTACCGAAGGAGGAGCATGAGGAGGTAATTCTCGAGCTGAGTGGTATCCGTGA
GACATTAGATAAGACCCAGAGTGCGCTCGACGTGACGCAAGCTCGCGTTCAGGCTTTGGAGTCGGGTCACACCCGGATGGAGGCCCAGCTTGACCTCCTA
ATTCGGATGCAGCAACCGATGGCAAGGCCAACTTCCGCGGCGCAAGCGCCTCCAAGTTCACGTGGGACGGATCCCGATACGGCTTTAGCAAACCCACGTA
GAACACCGGATGTGTGCACAATTTGCGTGGAAGGCTTAGCGTATACGCAAGTCCCTTCTTAGCAACGACCTTGAATGGTCCATTGAAGCGCGGATGCAAC
TTTGTCTTGAAGACAGCGGACACTGCATTTGTAGGTAGGTTTTTAGCATTGAGTAATACTTGGTCTCCGACTGATAACGTTCAATAAAACCTCTGTTTTT
AGCATCTGCTTGTTGTTTTTGTTGGTCTTGGCTTTCAGCCATTGCGTCACGCACATGTCTTAAGACATTCAATCACGTTGCGAGAAACTCACCTACCTTT
TTTGAGCAGGAGCAGGGCTGATATCAGCAAGACGATCGGCAACCTCTCCCCCACCAAGCCCTGAACCACATAGAGGTAGCGCTAACGGAACGCGAGGGTG
GGTGAGACCGTTTACGTAGAACGGAGTATAGCCTGTAGAGGCATGAACACCGTTGTTCAACGCAAATTCAACAACAGGGAGCATGGAGCTTCAACGCTTA
GGCGTATCAGCGCAAACACTGCGCAAAATTTCATTAATGACGCGATTAACACGCTCAGTTTGACCATTGATCTGCGGATGATCCGCTGTGGACATGTCCA
AACGGGTGCCGAGCACCTTGAAGATGGACTAAAACTTCCCAGTGAAGAGGGGATCTCTGTCAGAGATAATTGCTACTGGCAAGCCATGTTGTCGAAACAC
ACGGTCGATAAACAGGTTCGCTGTACCTTCGGCATCAATAGATTCCGGCTCTGCCGCTAGATGAGCCATCTTGCTCAATCGGCTAACAAAGACCACAATG
CCAGTGATGCCTTCCGAATCTTTCGGTAGGCAAAACACAAAGTCCATACTCATGGACTCCCAACACCCAGTGGGTACAGGCAGACTAGCCAGCGGCGCCG
CCGCATGTGCTGAGGGTTTATACCCGTTGACACATTTCACACGTACGCTCACCCACTTGTATAGTTTTGGACACCAATAACCCTGGCTTACTAAGCCGTA
GGTCTTCTCACGACCGAGATGACCACTAAAAGCGGTATCATGTGCCTCATAGAGGATACGATACTTCAGTTCCTCATCATGAGGAACAATGATACGCGAG
GTATCCGCGGTATCCGTGCGATAGTACAACAAGCCGTTATCGATAGAATATCGATGTAACCTCGCACGCGAACGTGCCGACAATTCTATGTCCGAGTCTT
TAAACTCCTCGCTCCCAAGAGCACGTAGCAAAGCTACACATTGTTCATCCTTGGCATAAGCCGCACGGATTCAGTCAGTGACTGACGATGAAAGCGTAGT
GACGTGAGCAAGCTCATAGTCAGGTCGGCGCGATAGCGCATCAGCCAAAGCATTTTGCTTTCCTGGCTTATACTTCACTTCGAGGTTATATTCGGCAAAG
AATGAAAGCCAACGAGCCATTCTCTGAGAGAGATGCGGCGACTGTGTCGCAGTGCGCAACGATGCATGATCTGTATAGATTACAAATGGTTTTGAGCCAA
GCAGATGCAATCTGAATTTGACTAGAGCGTATTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTTTCAGCAGCTTTGAGCTGTCGAGATTC
GAATGCAATGACGCGTTCGCGTCCATCGACATCTGTTTGTAACAGAGCACGGCCTATGGCACAGTCAGATGCGTCACATACGACACTGAAAGGCCGATCA
GGATCGGACAAAGCCAGTATTGGTGCATGAAGGAGACTTTCCTTAACTGCTTGAAAGCCTCATGTTTGATGTCACCCCAACACCAATCCACATCCCTCTT
AAGGAGATTGGATAATGGCCGAGCCATATCTGCATAATTCTCACTGTACTTATGCAAGTAACTGGCAAGGCCAAGCCACTTACGTAGATCTTTTTGGTTC
TTTGGAACCGGCCAATCGACCATGGCCCTTACCTTAGCGGGGTCCGCTCGAAGGCCTCGCTTCCCAACGAAGCACCCTATAAAGAGAATCTCT