Description :
From Genome Similarity Track
Location :
Scaffold_156:8173- 9645
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_156-snap-gene-0.15Adenylate kinase domain-containing protein 1

Sequence
1472 bases(100 bases per row)
CGTGCCCCCTTGATCCCAGAGCCACAGGACGTAGTTCCAGTCGGTGCTAAGTTATTCTTCAGCTGTTCACCCAGGCGACAaTCGTGCTCGAAAGCGTGCA
GTCGCTCGACGTATTTAaGGCGAAGATGCTCGGGTACGGcTTTGCtGGTAGCTCTCGTTTTCAGCAGCAGAGCCATGTAAAAGTACGcGGAGGCCCGTAC
GCTGACGCCAGGGAACTTGAGGCGCGCGTTGCCCAATAATAATAGCGTTTCATTGAGCACGCCTGAGAGCTCCTGTTCGATCCGCCCTGGGCAGTTCTTA
CTGGCGAGCGACGTCGCCAGTTGCGGTGGCAACTTGATGGGCAGGAGCTGGAATGCGAACTGGCGAGGATTGTTGaTAAACTCACGCTTGGCCTGCTCCG
AGACGCAGAAGAACACCTTGTTCTCGTACGAGACACGATAGAAGACGGAGCCCTTCACgaTGGCCTGCCAGTCTTtGTCGCCCGTGCCGTGCTGGAATGT
GACGGGGCAATACCCTTTCATTTCGGGGAACTCGCAGTCAGGAACAGACATGAGTGAGAGCAAAGATGCATCCACCGGAACCTTGGAGATGAGACTTTCT
GCTGTCGACACTGAGTCTTCGTCCAGGTATCGCTGTGGGTCGCTTAGGAATTCGAGGACGTTGCATTCGGTCGCAAACCACAGTGCTgTACCCTTATACT
CGACGCAAAGCGGTCGTTGCTCCGGTAGAGACGTGTGGTATCGACCGGCCGCAAGCTCAACGGGGCAAAACGACTGGAGCACCGGATGAGCTTGCTGTTT
GAGGTCGTCAATAGAGCGCAAGACACCACAGAGTCTCGTAGCTCGTCCCATGGTTGTGTCTGCTATGTACTTCCGAGCGCACGTCAAGTACTCGTCCACG
ACGGCACTAGCatGCGCAGTGGCTTGCCAGGCAGAGTGCGAATCGGCGTCGATTTGACGCACgTGgAAGGGCCCAAAGGTAGAATGCCAGCGATGAAGgA
acTCCAGaCGATGGCTTTGCCAGGCGCTGAACGCTTTCATCAAGccTTCCTttAGTACCTCGAGATCACTATCGGAGGCACTCGGTCGTACCCGGTACCA
GGCAGACTtAAATGAGCCTTGAAGCACGAAGGCAATCGCTGGATGGATCGccgccACACCATAGAGGCAACGTGAAAGCTCTTCGGCGGAGAGTAGGTAT
CCGTCGAGCACCCAGCCGTGCTGTTGGCAGTCCGATGATCGCAGACGCGTGGTAaTAGCTGCATGAACCAGCTTCCGGTCAGACAACCAGGCTCTCTGGG
TCCCCGCTCGCTGTGCTGCTTGGAgcTTGGCGAAGAGTGActCGTGCGGGCCTAGGCACTGTAATACCCAGTCGATAGCAGTCAGCGGAGAGACGTAAAC
GAGGCTGTAGCGTTGAGCAAGATCACGTGCCAGCCGtGTTTTTCCAGAGCCAGGCGAGCCAACGACACAACA