Description :
From Genome Similarity Track
Location :
contig_14:81720- 85018
Transcript NameFunction/comments
g2912.t1hypothetical protein

Sequence
3298 bases(100 bases per row)
CGTTCTGGGATTTCGCAGGCCAGGAAGAGTATCGAGCGGCGCACACCTTATTTTACTCCTCTCGGACGCTCTACTTGCTGTGCATCAATCTTGATCGCTA
CCATAACGCGCTCACAGCAGCTTCCGACTCGATGGACCAAACCGTTGATGATCGCATGATGGATGCGTTTGCAGACATTAACGTTTTCAGGTGGGTGCGA
ATGATTTGCGCTCACCACCCTCAAGCAGAGTTTGTTTTCTTGGGCACGAAAGCCGACCTCCTTCAGCATGATCGCCACAAAATCATCGCTGTCCAACAAG
ATATTGTGGCTCGCTTCAATTCCAACGTTCGGAGAATGAAGGACCGGGTGCAGCGTGCGCTGCAAGAACTGGAGGATGCCAGGTTTGAGATTCAGGACAA
CGACGCCGGTGCAGAGACACCTGAGCTCGATGATCAAATCGCTGGCTGCGAGCAGACTCCGTAAACAGCCAGGGCTTCTCTCAGAAGAGCTGATCGTTTT
TTCGAGTGCTGACTTGAAAGACGAAAGCATCGCTCGAGGAAAGTTGAAAGCTCTGCTTATGATGAGTGGCAGCTCCGTTTTGTTGCCCCCAAGTTACGCC
GAGCTGCTGAAGCATGCTCAGCAGCGATATATGTCCGGCCAAAAGCACTTGCCGTCATTTCAAGATAAAGTTGACACAGCATTCGTGTCAGTGAGCGAGT
TCATTGAATCGGTGACCTGTGCGTCAAAGCTGATCATACCCGAGAAGGAAATGCTCTCTGCGCTGCATTTACTACATGACACTGGTGACATCGTATGGTT
CGATGGTGTATCGGACGCTCGCCTACTGCAAGAGAGACTCTTCTTGGACCCTATGCTTGTGATCGAGTTCATCCGTCAGATAGTCAATCATAAAGTGGAT
GCCAAGGCATCTGTAAACGGCTACGTAAGCCACTCGCAACTCCAGTCACTACCTTTCTGGAAGGACGTTAGTTCAAGTACAATTCAGCAATTGAAGGAAT
TGCTGCTGCATCTAAATCTTGCCTATTCGGCTGGGAAGTCGAAAAAAATGGTGTGGAATTCGGATTTGATCATACCTGTGTATTGGAATCGCTCTCCGGG
ACCTACAAGCTCAACCGATGTTAAAACATTCTCAACAGAAGAGGAGAAGTCTGTTGGGTTAGTCGAATGCGTTCGATGGGAGTACTCATTCGAGCCTGCC
ATTCCTGAAAACCTCTATGAGAAGCTGGCGGTGGCGACGTATTCACCCTTGCTTCGATCAGAGCGAAAATATGGTGGGTCAAGCTTCATTGATAAGGTGG
TAGATGAGTACAGTGCCCGTGTTGCCAAAGAAGAAGACACGTCAAATTTCTCAGCACAAGAAGTTGTGGACGCCATCGTTTCTGTACTAAGTGTTAGTGT
TGCTGCTCAAGATCGGACACTTGCGTGGAAACAGCTTGTATGGTACTGCATGAATCTCGAGAGTTTGCTCAAGACATATCCGGGCTTGCTAGTGACGCGC
TGCACAGTGAATCAACGAGGTCAGCGGTTCAATGTTGATCAGCTTCTTAGTGATCAAGAACATTTCATGCAGCTAAATATCTGCACAGATCAGGAGTTTC
TGCCAGCGGATATGGACTGGTACACCAACAGACATCGCCACCAAAAGCTTGCTACCGACACTTCGAAGGCTTTAGTTGGACGTAGCGAGAACGCTCAGGC
TGCTGAAATGGCGCTACTTCGACAGGATATTTACAAGCTTTCGACCACCGTGGAAAAACACTCAGACGACATGGATAGACAATTTCAGCTCAACGGGGAG
CACATCGATGCCGCTGTAGACGCTTTGAAGCGTTCTCAGATTTCGTTAATCACGGGGATGCAGAACAAAGCGAAATTTCCTTCGCTCTGGACACTTGAGT
ACCAAGGTTTTGACAGCGAAGGCAGTATGGCTTCCAGCTTCGTGACTTCCCTCCAGAGAAAAGTGACAACGACGGTTATCGTAAAATTCCGAAGTGAGCT
CTCTGGAAAGTGCTACCATGATCCGATCGCCATTCCCGCTGCTAGAGAAGTCTTTTCACGTTTTGGGAAATTCCTCAAGGTACGTTTTATCAGAACGGAG
CACCATAGACTTGTCTAACTTGTGATTTTTCTGTCTAGGTGGGATTAACCCTGCTTTCCGCTGCAGCCCCGGATTTCGGTGGGAAGGACGTCCTCGGGAT
CATTACCGACGGTACGATCTTGTTTATCGAGGCGATGGCAATGCATTGCTAAGTATTGAATGATTCACCGCAGAATGCAAGAGGCAGATTGGCAGGAGCA
CGGAATTCCACGAGGTCTTGCACCGTGCTGGTATCTCGGATGACCGAGCAGTACGCTCTCAGCAGATGGAAACTAACCGGGACCTCAGCCCCTACGAAGT
CTTGACTCTGCTTAACTGCCTGCTGAGGCTACACAACCAAGACTTTCAACCAGACGATATTTCTCAGCTTTCCGGTTTGGTCTGCGGCGTTGTTGTGCAG
ACAAACGAATACATTTGGGCTTCTCGCAACGAGATTTTGCAGCACGGAAAGGATATCGTACTGGCCGTCGACTATTCGAAGCGACCAACGAAAGATAACG
CGAGTACTGAAGAGAAAGCTGCACTGGGTACTCTACCTACAGTCGAGATACTACCACCAATACTAACGGAGACACTATCAGAGCTAGTACCAGTCCGACG
GAGCGAGACTCTTCGATTATCTCCAGCGCCAAAGCGGATTCGCCTGAAGACAGCGTGGCAAGTAAGGGGATGCTTCAAGCTATGAGACGTCGGCTATCGT
CATCGAAAGCAGCGGTTCCGACTGCAGAAGTGCAGCGTTTCATGCTAATGATCATCGGAGCTAAAGGATTGCATGGGAGTCGCAAGCAAAGCCCATACTG
CATCTGCCGCTTAGAGTCACCTAGTGGTGCGCCTTTGCTTCAGGTTCAAACCTCTCCCCATTCCAATGGCGGGCAAATCCATCGTGGAGCTCACAGCTTT
TTGAGGTGGCGCTGCCAGTGGAGGCAACACGCGACGCAAGGATAATATTCACAGTCAAGAGCGGAAATGCAGTGGCCAGCACACGAGTTGGTCAAGGAAG
CACACGTTTCGTGACCTTGAAACTTGGCCAACCCACCACCCAGGAGGTTGGCTTGACGAAAAAGGGCAAACCTGCAGGAACGCTCGAGTTTTCTCTGGAA
GCGTTCGCTTAAGAACAGGTCGCTAAATTGACAAGAACTAAGCGAAACTACATATTCCAAACTTCGTTGCAACTTTTGTTTTCATACCAAAAGTGAGA