Description :
From Genome Similarity Track
Location :
scaffold_798:8172- 9436
Transcript NameFunction/comments
g10304.t1 hypothetical protein PHYSODRAFT_259536

Sequence
1264 bases(100 bases per row)
TGGGACTCGACGTACAAGGTGATTAAACGCTTTTTCTCGATCAAGGATACTATTGACACGTCCGACGATGAGCTCGCGGAGCTCATGCCCGCGCACCACG
AGGAAAACAAGCTGGCCGCTCTTCTGGACAATCTCCGGAAGTTTAAACCGGCCTCCATTTAGCTCCAGAGCGACGAAGATGTCACGCTACTTGACGTGCA
TGACAATTTCGACGCTTTAATCGAGCGCCACCCGTCGGTCGCTGAGTATCTGGGTGTGGATGCTCCAATTGTCAAGAGTGCAGCGTTTGAGAACACCTGT
GTGCAAGTGCTGTTGAGGAAAGAAGCTGAGCTATCGGCGGAGCAGCGTGGGTTACTCAAGGACTTTGTGGTGGATGTGTGTGGTCAAGTCAGTACTAGCA
AGGGCTGGGACGAGGATCAGACTGGGTTCGCTGATCGAGCCTTGTGCGTACTTAAGAAGCAACGCGTTGCCGTTCAGGTTTACCGGAGTGTCTGATTCAT
CCCGCCAACGTCGAATGCTGTCGAGCGGCTTTTCAGCAAGGCCCGCCATGTTCTATCACCTCACTGCCACGGCATCATTCCTATTCGCCTGGAGATGCTG
CTATTTTTGAAGGTGAACATACGTTTCTGTGGGGAGGGAGGGGGGGGGGGGTACGGTTTCGAAATTGGCCAACGCGTAAGTAGCAAAGGTTGCTCTAACA
TCAAATACAGGTTGCCATCTTGTACTTGAAATTGTTGCATTATACTGAATATTTCTTTTTTGCATTTCAAAAAACTCCGCGGAATAATTTATTCTAGTGA
TGCCTCCGAATTGTATTGCGCAGCAATTTTTGAAGGGCCTGATAGCCACAGTGACTGTACAAGTTCACCCCGACTTCTTCCTTTTGTCTTGTACACGAGC
GCATATCAACTTTAAGTTAGCAAGTGGATCCTCACGGAACGCCATGCTGGTGTGGCGCTAAATCCAGCGCTTTAGTAATGAAAATCCGACCTGAATTGGA
TTGAGATCTGGCGAGTAGGGTAACAGGAAAACAGCAGCGCACCTGTCTCGTGGATCATCTCCTGCGGTTCCTTGTACATGTGAATCTTGGCATTGTCGAT
ATCTACAATGGATCGTGACGATCACCAAGCATTGAGTAAGGGAATAATCTGTGACTTGAATACTTCATGAAAGCTTAGACGGGTGAATGTACCCTCCATG
TGACGGGGGTCACACAGCACTTCACACCGAGGAAGCTTGCTTGGAGTATACAAACTCCTAGTGA