Description :
From Genome Similarity Track
Location :
contig_120:81709- 84460
Transcript NameFunction/comments
g13943.t1POM62361.1 hypothetical protein PHPALM_28491, partial [Phytophthora palmivora var. palmivora

Sequence
2751 bases(100 bases per row)
TCTTCCCCCGTTCAACCTGCTCCCACTCATAGGTTATGAGCCCTGGCCAAGCCTCAAGCGACGAATTTCCACGCCTTATCGGAGCAGAGAACTTCGACGC
CTGGAAGGCCCGCGTATCCGCAGCCCTCGATGGGAAACATCTTCTCGGTTTTGTCACCAAGGAGGACTACGACGGTGTCTCTGACGACGAGAGCGAGGAC
AGCAGCGTGAGCGACATGTCCGACGTCGACGACACGCCTCAGTCCAAGCCTGCTGACGAGATCGACTCGGATGCCGTCGACTACGAGGAGAGCGATGAAG
AGCTCAAGCCTCCGTCTGACTCCGGCTCCGACAATTCCGGCGAAGGCATCAACACGACGATGAAGCGGAGCGATCTGCCCGAAATCCGTCCTTTCAGCCG
CCGTGACGCGAAGCGTAATGCCAAGCGGGAGGCGAAGAAGAAGAAACGCGTGCTCACTTCACGTGAGCGACGCAGGCTAGAAGCGAAGACGAAGGCGTTC
CTGATGAAGACCATGGACAACACGCACGTCCGCCTCGTCAAGAATCTCACCACGTCTTACGCCATTTTTCAAGCCATCTGCAAGAAGTATGAGGGTGCTG
CCTTCCATGGAGACCCTTACTTCATCCAGCACTTCCTCATGGAGATCAAATACGAGGAGTCAAGCGACTTGACGGAGTTCTTCCTGCAGCTGGAGAACGC
GATGAAAGCCGCGTCCGAAGCCACCGAATCGGTCATGACTGATGGACAGAAGTCTCTATACCTGTTCCACTCGATGCCCAAGACGTGGAAGGATGATCTC
CGCGTTTGGAAGGGTCAACGGAAGTATATTCCGTATGAAGAGCTCAAGCTGAGCATTGAGGCCAAGGTCCGCGAGATTCAAGCCCAAGAGCGCTACACGC
TGGCAAAAGGCACACCTGAGACGTGTACTACCAAGAGTGAGCAAGCCCTGGTTGCCGTGCCCGACCACACTGCGTTGAGTGCCCAAACACAGACGACTGA
TCGCATCTGTTCCTACTGTGACCGTCCACGCCACAACATACGCCAGTGCCGCGCCTTGCAGAAGGACCTTCGCGATGGCCGAGTAAAAGCGGGAACAGTG
CTGCCCGAGAACTTTGGCTTCAAGGGTGGCAACCCGAAGCGTGAACCCCCGTACAATAACAACAACTCGGGTCGTGGACGTGGGCGCAACTACCAAAACC
GTGGGCGCCAAGATCGGAGCGACAACCTGCAGGACTGTAATAACCGGCAGGTCCGCAACACCCGGCAGGATAGCGACAAGTCCGAGAACCGCAACCGGTC
TTTCCACCAAGAGCGCCGTGAAGTGGGCCTGATTGCTGTTGCCGCCACGGTCACTCCCTCAATCAGCCTGACTGCACAAGCCACCGTGAGCCCTGAGCCT
ACGTGGACTATCGACTCTGGATGTACGCGTCATGTGACGCATGAAGCCCAGTGGTTTACAACCATGAATGCGAGCAGCGGCGCGATCACCGTCGGTGGGA
AGCACGAGATCCCTATCGAAGGAACTGGCCAAGTGGAGATGGAGATCATTGACTCCAAGGGTTTGAAGAAGACTCTCACTCTACGCGATGTCCTCTACGC
TCCACGACTGCAGTTTAGCTTACTGTCAGTCCCAGCAGCTGTGAAGCATGACTTCCGCTTCAGCTTTGACCGCAAGCACTGCGCCATTCAGACTGATGAA
CGCTTCAAGATCAAGGCTATGATGGCAAACCATGCTGATCTCTACCAGTTCCAGGCCAAGCCTGTGTGAAGAACACGGCTCTCATTGCCGCCTCAGGTAA
GCAACGCTCTATGCTGCTTCTACACAAAAGACTCGGTCATCCTAACGTTCGCATTCTGCATGATTTACCTAGGAGCCAAGCCATAAGTGGCCTCGAAGAC
GAAGCCGTGGATTCACGCACCCAGTTCTTCTGTACTGCATGCACGTTAGCGAAGTCACACCGCTCACCGTTTTACTCTAATAGAACTGTTGAACGTGCTC
GATCTCCTTTGGACAAAGTGCATACAGATATTTGTGGTCCTCTTCCTGTACCCAGTTTAACTGGATGCCGTTACTTTCTCATCTTTATTGATGACTTCTC
TCGCTACATGTTCACCTATGCAATCAAGAATCGTAGTGAAGTGTACGAATGCTACGAGAACTTCAGGAAGAGGGCTCTGAACATCTTTCGGAGCGATGTC
AATGTCCTTGAGTACCCGAATCCTATTGAAGACTGCGACATTCAGGTTTTGCAAGCCGACAATGCCAAAGAGTATGAGAAACTTGGGTGCACAATTTTCA
AAAAGTACGGAACCCACGCTCAGTTTACGAACGCATACACCCCTCAGCAAAACGGTGTCGCTGAGCGGCGCATGAGAACAATCATGGAGCGTGTTCGTGC
CCTTCTACTTGACGGCAATCTACCAAAGCCTTTGTGGGCCGAGTGCGTTCGCCATGTGACTACTCTGATCAACATGACACCTAGCTCAAAGACGAATGGC
AAAACTCCGTACGAGTTGTGGTACAACCGCAAACCATCCATGGAGTTCCTTAAGGTATTTGGATGCAGCGCGTACGTGCATATCACAGAACAATATCGTG
ACAAGCTGGACGCACGAGCACGTTTGTGCATGTACCTTGGTCTTCCAGACCACAAGAAAGGCTACCGTCTTATGGACGTCAATACCCATGCCATTGTATA
TAGCCGTGATGTGGTTTTCAAAGAGGACGAATTCCCTCGCTTAGCAACACT