Description :
From Genome Similarity Track
Location :
Scaffold_3248:817- 3421
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3248-fgenesh-gene-0.0Kinesin heavy chain

Sequence
2604 bases(100 bases per row)
GCGGCGGCGACGACCGAGAGCAGCAGCCGCGCGGGCATTCGCGTGTGCGCGCGCTTCCGACCGCAGAACAAGCTGGAGCTCAAGCAGCAGGCGGTTGAGT
GCGTGCGCGTGGACGACGACAACACGCGCGTGCAGGTCGAGAAAGGCGCATCTTCCGAGAAGCTCACGTTCACGTTCGACGAGGTCTTCGGCACGGCGTC
GACGCAGCTGGACGTGTACAATGCAACGGCCAAGCCGCTCGTCGAGTCCGCTCTGCGTGGGTATAATTGCACGTGCTTCGTGTACGGCCAGACGGGCACA
GGCAAGACGTTCTCGATGGAGGGCGTGCCCGGTGACGCCGAGTACGCCGGCATCATCCCGCGCGTCATGAGCGACATCTTTGATGGCATCCATAACATGC
AGGCCGAGCTCGAGTTCATCGTGCGCGTGTCGTACATTGAGATCTACCTGGAGAAGATCCGTGACCTGCTTGAGCCGGCCTCGAACAACCTGAGCGTGCG
CGAGAGCCGCGAGCGCGGCGTCTGGGTCGCAGGCGCCACCGAGGTCTGCTGCGCATCGGCCGACGAGATGATGGCCGTTATGCGACTCGGTGGCGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCATCTCGTCCACGCGCATGAACA
ACGACTCGAGCCGCAGCCACTCGGTGTTCATCACGACGATCGAGCAGCGCAATGTCGCCACGGGCTCGACGCGCAGCGGCAAGCTCTTCCTGGTCGACTT
GGCCGGCTCGGAGAAGATCGGCAAGACCCACGCTAAGGGCCAGACGCTCAAGGAGGCCCAGCATATCAACAAGTCGCTGAGTGCACTAGGGAGCGTCATG
AACGCGCTCACGAGCGGCCAATCGAACGCGCACATCCCGTACAGAGACTCCAAGCTCACGAGGCTGCTGCAGGATTCACTCGGCGGGAACTCGGAGACGA
CGCTGCTCGTGTGCGGAAGCTGCAGCAGCTACAACAGTGAGGAGACCGTGTCGACGCTGCGCTTCGGCACGCGCGCCAAGAGCATCAAGAACAAGCCCAA
GGTGAACGAGGAGAAGACTGTGGCCGAGTTCAAGTTGCTCATGGCCGAGAAGGACAAGCAGATTGCGGCATTAGAGGCACAGCTCAAGCAACTCAGCGGA
GAAAGTACTGCGACTGCCGAGGTTGTTGTGGCTCCAGTCCCAGTCCAGTCACCTGAGGACGCTGAACAGATCCAGCGAATGGCTGTGAAGATCGAGCAGC
TGGAGGACGAGCAAGCGAGCAAGACGGTCGAGATGGTGACGCTAGAGGAGCGCTGCGTGGAGCTGGAGCTGCGCAACAAGGATTTCGCGCACAAGGAACT
CGAGATGGCGACAACAAAGAGCAAGAACGACGAGTTTGTGCACCAGATCGCGTTTCTCGAGAGCGAGTTGGAGGCCAAGGCCCAGGAGTGTGAGGAGCTC
AACAAGATGTTGCAGGCGAGGCGAGACAATCTTATTGAAGGCAGCAGCAGCGATGGTGCTAAGATTGCGACTAAGAGCACGTCAGACGTGGCTGGCAGCC
CACCTGCGGTCGTTTCTGAAGCCTCGGTGCTGTCACAAACTGAGTCTCAGGTGGTCCAGGCTGGAGCTTTGGATACCACGTCAGTGACCGTTAAACTAAT
GGCAGACAGTGCTAACTTGGACAATGAGCTGCTCCGCCAGCAGCTCCACGCCCGTGCCCACGAGCTCGCAATCAGCTCGCGACGCATCGAGCAGCTTGTG
GAAGAGCTCACCAACTGCCGCAGTTTTTACGAGAGTCAAGTGTTTGCGCTCGAGGAGAAGCTCCGTGAGTACGACGCATACGTAGGTGCGCTCACGCAAG
TCTCAGCTGTCGACGGTGGAAGCGAGCACAAGGCCTCGCAGCTCGACCATTTCATGCAGAAGGCAAAGACGCTGCGCTCTGTACGAGGTGGTGGTGGTGC
CAATGGAGCAACCCTGCCAGCTCTGTCGACATTCAAGCCACAACTGAACGGCACCAACGGTACGTCAGTGCCTGCCAACATGTCGACAACAGCCACAGCG
TTACACCGAGAGCGCATTGTGAGCTCGGCGACGTCGCAGAACGGCTGGGAGGTCGATGCCGAGGTGTTCCCGGTCGCGCCCATCGACATGGAGTCGCCCG
TGGTCAAGCGTCTAATCTCGAGTATGCCCGAGCGCGGGCGCGAGAAAATGGCCAAGTGGCTCGTGTTTGTGCTCGAGGGGCGGGACATCCGCTCGAACTT
CCATCCGGAGATCTCGGTCGAGGGCATCAACGAGAATCTGAACCGCGACATGCGCAAACTCATCGTGCCACTGCTCAAGAACAGACGCGACCTGGATGTC
CAGTCGTTTGTGCGAACGCGTTTCGTGCGTGTGACCGACCTCAAGATCACACTAGTGCACAAGCATCAGGACACGGTCCATGTCGAGACGACGGCGGCGG
CGGC