Description :
From Genome Similarity Track
Location :
Scaffold_103:81673- 82996
Transcript NameFunction/comments
Sapdi_VS20SDRG_15821hypothetical protein

Sequence
1323 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGTCTTGAGCTTGGTGCAGACCGCGTCGCGCTTGGCCTTGCACACGCCGGCGCTCACGTAGCTCGGGATGTTGCTGACGCAGTTGGCAACG
GCCGTGTCGCCCTTCTTGGGGCACGCACCGCCGCCGTTGGTCGAGCCCGAGCAGATGGGACCGCGGATGCAGTACGTGCTGTCGCCTTCGACGCTGACGT
TGGTGCAGGACTCTTCAGCGTGGTGGTGGCGGTGGTGGCGGTGGTGGTGGTGCTCGGACGCCATCGCTGAAGCGGTCGCGAGGAAGAAGGCGAGGTAGCG
GAACTGCATGTTGGTGGAGGTGTGAAGCGCGAGGCAAAAATGAAAGTGAATACATGGGACTGCGGCAAGAGGACCACGAGGACGCTTGGAAGAACCATCG
AATTCGATGAATAGTTGAAAGAT