Description :
From Genome Similarity Track
Location :
scaffold_418:8167- 14860
Transcript NameFunction/comments
Pl_105043glycosyltransferase

Sequence
6693 bases(100 bases per row)
GCGGGTGTTTCGTACATCTGGTAGCCACCATGACCGTGAGCAGGAGCCCCACTAGCGTTTGACTTGGTCCGCACGCGACTGAGGTTTCGCTGACGAGCAG
TAGCTGGTGTCCTCGTGTTGCGACTTGCGCGCTCGGCACGCATGCGGGCATACCGATCACGGTCACGCTGGGCTTCTGTCTTGGTGCAGATGACGCCGTT
CTTCTTCGTACCAGCACCCAACAGCAACACCAGCGCTACGACACTGAAACCTGCGATCGCGTAGAGGTACAAATACTCCTTCTCCATCATATCGTCGTGT
GTGTGCATGTACACGTATCCTAGATCTGCCAAGTAGAAAATGGCAAACAGCATGGTCGTCGACGAAGCACGACCGCGTGTGGAAAACATGCCGATACAGG
CTGACCAAGGGGCTGAACTCGTACCCAGTCCCATGAAGAAGTACATGAGCATAACAACCAGGCTGATGTACAAGCCAGAACCTTCCTTGTCGCCCAGGAG
CTCGGATGTCTCGTTGAAACCCAGCACACCAGCACAGATCGCGACAGGGATCAGCGTTCCAAACAGGATGGACTTGTGGTCTAGCTTGTCGATAAAGAAG
ATGGCAATCACAGCACCCGAGATCTGCAGTGCCATGGCGTTCACGAATAATTGGTCCTGGTCAGTGTATTCACTGGCACCCTTGTAGCTAACGAAAGCAT
TCAAGAAGCCCGTAGTCAGCGACGACACCAGCATCAGAAACAGACCGACAAGGAACTTGAACGCGCCTGCGCCTCCTTCATCAGCAGTTTCCTCTTCACG
CATAATCTTCAGCTCCTCTTGCACGTCAGGCTTACGACGCAGAATGACAAGACAGGCTTCGCATGCGTCCCAGCCCTTGCGGTCTAACACCCAGTACGGA
CTCTCAGGGAACACGTTCACCACCGGAGTTACCAACGCGATGACAATGCAGGCGGCAAACGTCTGCCAGATCCATCCGAGTTGGTTCACAGTCGCGAAAA
CGCCACCAAGCAAGCTACCAGCAATGAAACCCATGCCCAACAACAGGATGGCTTTACCACGCATCTCTTTGGTGGAGATCTCGAAGATGTAGATAGCCAA
AGATGGCAGCAAAATACCGCACGAAGCACCAAGCAGGCCAATACCAGGCATCAGTAGGGTCGAACGAAGATCGTCGTTGGCACTGACAGCCACCATTCCA
AGAGTACTAAACAGACCACCAGCAACAATTGCGAGACGACGGCCTAGGAAGTAGTTGAGGAATCCAGCAATGATCGTGCCCACAATACATGCGCCATAGA
GCATGTACGTAGTTGTGCCATCACCAACGTTTCCACTAAGCACACCATCGTACGTCACCACGTAACTCGCAAAACTTGCAGACTGCTCCAGTGTTGAAAG
AAGATTGAACAACCAGCCGACACCAATGCCACCGAGGACACCCATGAAGGCCGCAAGTGAGAACGCGTACTGTGACGACGCAGACATGACCTTCGAGAAA
CCTTCATTGTACATCATACGCGTCTGGATGACGTTCAAGAACGGAATGCACGACAAGATCACCAGCGGGATGATCATACCCGTACAAAAGATGAAGTCGA
ACAGGAATTGCAATTGCTGGAACACTGCGTTGCCGGCAATCGACGAGTGGGGGAAGCTCCACATGCGGAAGCACTCGTTGATGCCGTACAGAGCAGCAAC
GTACGCGAAGAAGAGCGAAATCGAGTACTTAAAGGTCCAGTCCATCACGATCCAAGTGGCCAGGAAGTATGCCGTGACAAAGCCAGCCATGGTGGCGAAA
TAAATCACAGCACGCGTAACCGGGCTCATAGAACGCATTCCCATACCAAAGCCGTGGAAAACACCCAGGAGAAGGATCGTAGCAACGGCAGCACCAAATG
AATATCCGACATACATGACATCGGTTGTCTCGAGAGTAGCCACGTAGAACATGAGCAAGAAATGGCGGCATTCGCGTAGGATAACAGTGACACGCGAGAT
CATGTTCGAGTTGTGAAGCTGCTCTAGGTCACCCTTCCACCAGCCTACCCAGCCACCCTTGTTTGCCGGATCATCATCCTTGTAGTCTTCCGGGGCGAAC
ATCCACATGCACCACTGCTGAACATCCACTTTCGTTTTCCTGAAGTCAAGGCCGTCACTGTTGAAGAGGAACGGGCCAACCACCCACAGAATGGAAATGA
ACCACACCGAGAACGTCTGCACACCATAAGCCTGTGCAGTCTCACAGTAGTCCGATGCGAACGTGTTGTCGTTGGCGGACGCATCAGTCTGACAGATGTA
GAAGTTACCGAACGTCAAATACACGAGACACAAACCGATCAGCTCCCAAGCCTTGCGATAATGTGAACTTGCATACGCCTTATACAGTAACACCAGTGTT
TCTCGAGAAATCTTGAAACCACGTCCCGTAGCCTGGTACTTAGCACCACCGTGCACGATGTTGTTGTCGAAGTAGTGCATCGTTGTACCGACTTGGAACA
CGAAGAAAGCAGGACCGAGTGTAATAATCATATCAATGAAACGAGTCATACCGCGAACAAAACCACCTTCACCAAAGTACACACACATCAGCGGAAGCAT
CAGGAAGGTACCAGCTTGGATGTAAAACTGTGTGTTGAGCACAGCCTTGAGGTCCGTAAACACACGCTGGTCGAAGTTGTTGGCAATATTTTCGGTAATC
ACAGCAGTCGAGTTCATGTCGTAAACAATCTGCTGCTGCACACCAGCCAAAGCCAGGTACACCTTGCAGTACATGTACACAAACGTCGTAACAATCGTCA
TCCACGTAGCGAAGTAGAAACCCGTGTGCGAGTAGTACATCGAGTTCAGACGGAAGAAGTCCATGAACTGGCCCATGCGGTGAGCCTCACGAGCGAGAGA
CGTCTCACCGGCACCGTTAGCCAACTTACCCTCGAACATGGAAATCTGTGAAAGAGCTACATCACGACCCTTACCACACTGCATGAATTCCACGTGGGTC
ACGACACCACCACGAAGCGTAGAGTTGAAACCAGCGAACACATCTTCAGACAAGTTGATGCCCTTAGATGCCTTGGACACACCACCACGAGGCATAGCAA
TGATCTTATCGAAAATATCAGGGTGACCGTAATGCATACGCACATACAACGGATCGGCCAGCACACGCTGCGAGAGCGTCACGAACACAAGTTCCTGCCA
CGACTTAAACTTCGACAGCGACGAGGCATTACCCGTGAAAATGTGCTCACGCATACCGATAATGGACACAGGCTTCTTCGACGGGTGCAGATCAGCGGTC
ACAAGAAGCTGGGGCATCTTCAGACACTCCTCGAAGTAGTGCTGCTGGTTCATATCAATGGTCTGCAGGTATTCACCACGAGTGAACGGGAGCGCGTTGT
TCTGGTTCTCGGGCTTACCTTCACCAAGAATCGGGTCGCCAGGTAGTTCGTAACGATACACTTCAGCAATTTCGTTGCCTTCACTCTTAATCAACACAGT
GTCGAACTGCTTGCCTTGGTCCATTGCAATGGTATCGACATAAGCCACACGCAAGTTCGGGTACGTTTTCAGAAGGTAGTCGATGTCATCAGCCTGGGGC
TTGTTCTCGGCGCGATGCTTACCATACACCTGACAAGCACAAATGTACGAGAATTTCAGGCGCACCATGTCCTCGAGTTGAGCTTGTTTCTGCTCAGCAG
TCTTGCCGGGGCTTGAACCAATCTCCAGCCAGTGCAAAATCTTGATAGCATCCTCGTACAGCATCATACCCTGAACGGTACGTGCTAGTGTCTGACCACG
GTACGAAGCCCACAGACGAATTTCCAGCGGGTAGTTCGCTTGCGCTTCTTCGGCAGTGCTTACATCAATACGCTCCAAAAAGTTTTCCCACTCTTCAGGG
TGGATCGTGATCAGGTACTTCAGAATAGTAATGTTCTTGCCCTTCTCCTCCACCTTCTTGAAGACTGGGTGGTTGACCAGTGGATCGTTTAGTTCGGACA
GAGAGATCAGCACACTTTCACTGTAGAACGGCGTCACGACAGAGAATGAGTGCATCTCCTTCACAGACGTTAGCTGAGGAATGTCCATCAAAAGCGATTT
CATGAAGAAACCAAGACGACGCTGGGCTTCAGGAACACGAGGCATAGCGTCAGCCTTCTCGAGCGACATCAACAAGTAGGCGCGAGTAGCAGCACCCATC
GCCGTGTCGTTGTGGAACAGGTTCACGAGACCACGAGCAGCAAACACGTAGCCATTCGCGCTGGAGCAGAACTTGGAGTTGCTGAACTTGGCAGCAAGCT
CAGGACGGTTCGCAAAAATGCGAATGGCGTTGAGCAGGTTTTCCATCTTGGTCACGAAGTTGCGGACAACACCCATGGTGTGCACCCTAGAATTCGTCAT
GTGCGAGGACTGCGCATCCGGGTCCGGGAGGTCCATCACAGCCTCCAAGAATTCCATTGACACAGTGCGAAGCTGCACGAGGCTCTTGGCGTCGAACGTG
CTCATGAAGCTGCCGTTCGCAGCAATTGTCTCCATTTGGCGGAGAGCGTCGAGAACATCAGCATCGTCACTGCCCAAGAGAGCCTCCATCACGTACATGC
TGGCTGTGAAAAAGCTGCGCACAGCTGATAAGCAATCCTTCTGCACCATGTACACCTGAAGCTGCGAGTCACCCTTGCCTTCCTTGGCAATCTTCACAGT
GTAATCCAGAGCTTCTACCAGCTTACCAGCAGAAAGGAACACAGGCTCGAATACGTCGCCCGAACTCTGGATATCGTACTGCAGAATGGCAGCCTCCTTG
TCATCCACAAGATCACCCTCGCGGAACGAGTTAACGATCTCATTCCATACCACCACGAAGCGCAGCATCATCTGCGACTGGTATGCGGCGGCCGAACCAT
CGGCGGCAGCGTCATTGGAACGGGCAAGGTTGGTCACCACCTTCTGATCAAAGAGCTGGGGAGCCACACGGAAAGCCTTCGTGATCTCCTTGATGCCGTG
GATTTCACCCGTCTTCATGATGAGACCCTGAAGGCCACCAAGTGTGGCCTGGAACACCGTAAAGTAAATCTGGGTGTCGTAGTTGAAAATGAAAATCACG
GGCAACCACAGCGCAGCGATGACACCAAAGTTGTGGAACGACACGACATTGCTACCGTATTCCAGCTCCATCTCGTAGATAGCGAGAGATGGAAGGACCA
ACGGACGGACCAAAATGAAGTACGACACGAACGCCTTCAACGCCCATAGCACGAGCCAGAAGGTGATGTACTTCATCTGGTAGCTAAGAGGAGGTGCCAT
GTTACGCCCAACATAGCACGTCTCACCCTCACGGATGAACTTCGCTGCGAATGTCTTGGTAATCATTGTTGGGGAGAATGCCTGAATGACGATGATCAAT
GCGCCAGGAAGAATGTAGGCTACCGACGCAGGCGCAGCCTTGTCAAGCAACTCTGTGTTCTTGCTTGTGATCAACGGAGTGTAAATCATCAAACCGAAGA
TGCCGGCAAAGGCGCCATTCCAGAGCATACGAAGCACCAGAGCACCACCATAGTTGAACGAACGCGAAGACGTCTCGGATGACTCACTAGCAGTCAACAA
GTGCCAGCCGTGGCACGCTTCCAGTACCGTCTTGCAGAATCCCATCGACGACAGTGCAAACACAATACCGACGTACGTCAGTTTGACATCCTGCTTCTGG
TAAGGCTCGACAACTTCACCCATGGATCCAAACTGTGCGAACCACTGCTGTCCTCCACTGGGCGAAATGGCTGAAATGAAAGCGATTGCCATGAGCACCA
TCATGAACATCATGTTGAACTGGAAAATTCGGTAGTAGTTAAGCACAAGTGTGAAAATACTACGATGTTCGTAGTACGTCTTGGTGTGTTTCTTGGTCAA
CTCGTCTCCAATCTGTGTGATATCAATGTTGAGGCAGTACTTTTTCCAAAAGTACTCGTTAATATCGTCGTAATTCCGTACTTGAGTGTGTTCCAAGTTC
TTGCCAAGACTGTTCTTCCTCTGCATGTTCGATGCCTCTTTCCAGATCGGCCGCACCACCTGTCTCAAATACCATCCTTCCGGTACTTTTTGTTGTCCAA
GGAAGTCCTGATTGAGCATATTCAACGATTGATGGTACAAGTAACACAGACTCTCTGGCATGTGGCGCAAGTTACCAGCTTCTCCCCAGAGGAGCAAGAA
GAGCATAATGTCCATATGCAGTGGGTTCTTGAGGTCTCCTTGTGGCTGCCCACAGTACGTGACACTCGAAACACCAATGAATTGACACCATTCCGTGTAA
TTGCTCATGAGTTTCTTGTGCAACGTCACGACGTGATGTCCTGGTGGGTCCTGGGGCTTAGAGCGAGCCTTGGAATTGGCCAATAGCAGCAGCACATGCT
CTCGCTGGTTGTCCACACTCCCCGATTGGAAGCCAAACTTGTTGTACAGCACTTCACAGCAAAAGTCAATGGATACTTCATCTGCAAAGTCGCCTTCCAA
GCCTCCTCCACGCAATTGATTGCCGCCTTGGGTGTTGGGCGGAAGGACGTCCATCATGCTCAGACGATCGCCAAACGTCCCGCGGTTGTCGCCATAGTTG
CTGCGGTTGTTGGACGTGTTGCGCTTGCGGTCTGCGTCCAGTTGAAAGTAGTTGGAACCAGCTCGACGGCGGTCCATCTTGCCTCCGGGCGTT