Description :
From Genome Similarity Track
Location :
Scaffold_171:8167- 10282
Transcript NameFunction/comments
Albla_Nc14090080

Sequence
2115 bases(100 bases per row)
GTGTATAGCGGAGTAGGATCAGTGATCGCACCCGCAGCCAGAAGTCTGCGGTGTCAAACGATGAGATCGTCTAGTGCTCCAACGTGAGGCAGTGTGCGCA
GCTTCTTCAAGACAGTGCTAGCGCCCAGCGACTGTATGCCGCGCTCTCTTAAAAACGTCACGAAGTGTGCTTCTGCCTTCAAGGCAAGCGATATGACATC
ATCAGGATACGATGGAATTTCTTGATTCAGTTTGAAGCCTTCGATGAGAAATAGCTTCATGAAAGCGATCAGTATCTTCGCATCTGACTTCTTTCTCTTC
TCGCCGTGGACGCTCCACAATCGCGGCTCCTGCGTGTACCACGTGTACCACTTCGCATGTAGGTGGGTGACTGACGATTGTTTCCTGTGTCTGATGGAAT
ATAAGACATCATCTTCCTCACTTGTCCTCTTCAGTTGTTTGATAGGTCCTCTCAGTTTTTCCTCCATCCTGTCCAATCGCTCGTCTTGCCGAGGTCGCCT
TGTATCGTCCAGCTTTGTCTCTAGCACATCCATTCGCTCGTCTTGTTTTTTTTGCGTACGCTATGAAGTGCTCAGTAACAGGAGCCTGGTTGCGAATTAC
TCTGCGATCTTCGTTCTCTGTGCTTTCTTTGTCACCAGATATGTCTTCTTCTTCTTGCGCGTAGGAAACTTGAGTGGCGACGAGATGCGTAGGCCACGCG
TATACTTCGTGAACAGTGCATTTTCTAGCCACCAAGCATTGTTCTAGCCGCTGGACTGCTGGGCCGTCGGGATGCATCACCTTTATCAACGGGTAGTGCA
AGATCAGGTACGCCTTGAGAACGTCCAAAACTCGCTGACATACGTTTTACTTTCCAGAGCCGAGCTTCTGGCACGTTGTGAAGAGCAACGCCTGGACTTC
TGCGATCTTGACCTGCGTCTGCGCATCGAACATGTTCAGATAAGCAAGTGGCACACGATTGGTCGGCTTCCTAGCGCTCGGCACCTTCTATCCATTGTGA
TCCTCGCTTGCCGTGTTGAAGACATACTTAACGCCTTGTTCGTAGTTCTTATGTTCCACGCTCCGCGATCGAAGATTCAGCGGGCGGTGAGATGCCAGGA
GCTATCGGCATGCTGGGCGTCACCATGGCGAAACTAATGTGACGTCCACTGATGTTGAACTCCTGCACGCTTTGCGACACGATTGAGGAGGCAGTTAATG
TGGGTGTGGAGTGTCGAGGACATGGCTGGGCCGATGGTGATAGTATCTGGGTGTCCAATGACGGTGGCTAGGTGGTCTAGAAAGTCGATGAGGGGCGTTT
CAGGACTGAGCACGACGCTTGTACTGGGAGGTTGTCTAGGAGGTCGGTGTGTGGTGCTGTTTGGGTGATAAGCGCCAAAGAGATTGCGTACAGCGGACAC
GTAATAAAGTCAGTTTCGGGGAAGATCGATAGCTCCTGCTCTTCACACGTCTTCACACGGTCGAAGCGCACAAAGAACACGCCACCAGCGTCGAACGATA
CATTCTGCTTTCGAACAAGTGATAAGTTGGAAGCACGTCCAAACATGTACCACAAAAGACTCAGTAGAGCTCCATCTTGGAAATCCGCTTGAAGAGCAAG
CATTAGCATACAAGTAATAGCACATCATTCTTCTCAAGTCACTTTTTGTACATGCAATACCTTTCTTCACGAAGCCTCCACCCTCTCTTTTCACGCAGTA
ATTTTCAAAAGTTCTCCCCATCTTAAGCAGCCGTACTTCAAGCAAAGATCAAATTTGAGGGAATTGTTCGAGTAGCCAGTGCTTTACTTGCCTGTAGTAC
TGCATACAAGAATTTCTGGCAAGTGACTTGCCACACTTACCTTCGTGAAATGCAAGATACACTCCGAACGTATCCATTACCGACAAAAAAACATTGTCCA
GTGAAATCACGCAAAACACAGCTGCTAACATACTCAAGATCAACATCGTCAGACTGGATAAATCATTTACAGCAGTAGGTCTTGCTCGCTTGGTGTTTCC
AGGCAGCAGATCATCCAAGCCCATGGAATCGTCGGATGATGGTCAGATATGTAAATGATACGTGTTACACTTGATGTTTGTACAGGAATACACATATTTG
AGCTGAACCTCCGAC