Description :
From Genome Similarity Track
Location :
Scaffold_576:8167- 9202
Sequence
1035 bases(100 bases per row)
CCTCTGAAGACAGCTTCGGAGATCATTCAATTGCCCACGCTCGAACAGAAAAGGTTCTTGCGTGATCTCCGTAGTGGCAAAGTCAAGCAGGTCTGCGTAC
TCGTCGCGGAAGATGAGTACGCCAGTGACATCCGATTGGCAACGGTCTTTGCCGATGATGAAAGAGTTCTCAGTATCTCATCAATGGACGAGAGTGTCCT
TGATGAGAAGTCTCGGATTGCGCGATATACATCCCAATCGTGGGAATCACTCGAATCAAATCCTCTCTACGATGATTTGATGTAATTCAGGGATGTATTC
CCAGAAGCATTGCCGTGCGAGTTACCTAATGACAAACATACTCGTCACGAAATCGACCTGAAACCAGGTTCGAAGTACTGTGTCATGAAGTGATGGCCAT
TGCCATGTGAACAAGTACTAGCGATCGACAAGTTCTTTGCAGATTTCTGAGCAGCCGGCCATATGAGGGAATCAACTTCCCCTCACATAGTTCTCCGACC
TTCTGTATGCAGAAAACCATGGGAGGATGGCGGATAGTATATGCCTTTAACAAGTTGAATGCTGCAACTATACCAGCTCAAAGGCCAATACCAGGGAAAT
ACGTAATCATCGATGGTATGGCAAAGAGTACCATTTTTTCATCAATGGATCTGATGAACGGATTCTATCAGATCCTTTTGAGAGACGTGAATATTCCTTT
ACTGCAGTGATCCCCCCAAGCAGTATGCTTTGGGAGTGGTTAGTAATGCTACAAGGGCTGAGTAATGCCCTGCCACATTCAACAGATGAGTTACAGATCT
GTTGAGATCTGTGCGAGAATTCACACCTAGCTATTTCGATGACGTGTTCGTCCATAGTGTATATTTGCTGCAGGCGAAATACCACTTCTTGGATGAATCG
TGGGTAAGCACGGCGTCCGGCTCAATCCGGAAAAGATCAAGGAGATCACTGACTGGCCGGTGTCTACCGACATAAAAGGACTCCGAAAGTTCTTTGGCCT
AGCGGCGTATTTGCACAAATACTCGCACAATTACG