Description :
From Genome Similarity Track
Location :
Scaffold_25:81661- 83185
Transcript NameFunction/comments
g13297.t1hypothetical protein

Sequence
1524 bases(100 bases per row)
CATGGCCGAACTCGCACAGATACATCGTGGGCTTCCAGCCACTGTCAAGGTGATGGATGTCCGATCCGCAGGTACCGCAGTGAGAAATCTTGACCTCGAC
TACGTCGGCACCAAGAGGGCGAGACTCGTACTCGAATGGTACAATTTGCCGGGCGGCTCAAAGGCAGCGTAGGCATTCACGGTTCTCGGAGCGGTTGACA
TCGTGCGGATGGATCTAGGTAAGTTCCAAAATGATCAATGCTTCTGTGAAGGAGAGAGAGAGTCGTTGATGCAGGCTGTTGTAACTTGGGGAACACTGGG
TCGTTCTTCGGCTCACCCTCGGACGTCACGGAGACCACATTGGCGAGCGTCCCAATGCCGAAAAACAGCGACAGGAACCGAGCGTTGCCCACCGCTCGGC
ACACGTGAAGCCCCGCGATCGCGAGCCACACGACGTTCAGTAGCGCAGTACCCGCCACTGGAGTGTACAGCGTCGAGGCAACTACCGGTACCGTGTAGGC
GCGACCGCATTCCACCTGGCTCCATAAGGTCTCAAAGTGTCTTGCATCAAAGTCTGCGCTCTCAAAAGAGCCCGTTACTGGACTGGAGTACACTTGGACG
CCGTACATCGTCGCAAGTAGAGCCAGGAGAGCTCCTGTGGATTCCGGGCAGCGTACGGGGTGCGAGAAAAGCGGTGCGTTATACTGCTACGGCGACTGGG
GCGATGGTGGTGCACGTGGTGACGGGATACCTGCCAAATTGGTCGGCGGGGGAACAAAGAGCGCTTTGTCGTTTTTGATTTGAGCAAGCGAAGGCGAGAA
AATACAACCAACCTACTCGTCCTCTCCCGGGGGGTACTTTGATTCGTTCTCGTCTTCCCCCAAGTGCATGACGCAAGCAGTACGCCTCGAGACCCATTGA
AGCACCCGTCCTTCTTCCCAGAGCAGCTCGAACTCGAGCTTGGTCGAATCAAGGTGCACCTGAGCCGTGATCGTTTTAAACATCGCTGCATGGCGGGCTC
TATCGAACGCATCCGTGCTGTAGTTGCTCATGCCTTGTAAAATAAACTCGCCGTTGACGATCATCCAGTTGTTGTTGACCCTGACGCTGGCCTCGCGTCC
AGTCTTGATCGGGATCCCCGCGTCCTTGAATTTGCGTACCCAAGCCATGTTTTTCTGTTGGAGCGCGCTTTGTTCGTCGACGATCATGCGAACGACACAG
CCTTCTGCAAGCGCCTTCAGAATGGTCTCCCCAATGTAATCGTTCGCTATGGACCTGTTGCAGATGTCCAGCGAACCATGCGGTCTGGCGGCCAATCCAA
GGTAGTGCATGAACTTGTCCTCGGCGTCGGCGTCTCGAGTAAACCAGGTCTCCTGCTCCACTGACGCGACGCCTCGTGCCCTGGCGGCTGGGCGCGTGTC
CTGCCCAACGGGTGCCGGTAAACGAGCCGGCTGACCAGCCTGCTCGAGCGGCACCACAATGCCACACCTTGGCTGCAGGCTCTCCCCCCGCTCGTACATG
GCATAGTAGTGCGCGACCGTTCGT